Psilocybe hoogshagenii : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. hoogshagenii

Originally described by R. Heim in 1958 from Oaxaca, Mexico, Psilocybe hoogshagenii is one of the most iconic and well-documented species in the Psilocybe mexicana complex. Its prominent umbo is immediately recognizable, and it was featured in the 1957 Life magazine photo essay by R. Gordon Wasson, Seeking the Magic Mushroom, thus introducing the western world to psilocybe mushrooms. It is known to be consumed traditionally by the Mixtec, Mazatec, Mixe and Zapotec peoples.

Description

• Pileus (Cap): Conical to bell-shaped to convex, reaching 18–76 mm, although a range of 1–2.5 cm is most common. It has a long, sharp papilla up to 4 mm. Smooth, somewhat sticky when wet, often with ridges extending halfway to the center of the cap. Reddish brown to orangish brown to yellowish; hygrophanous, fading when dry to a straw or fulvous color.
• Lamellae (Gills): Adnate to adnexed; brown maturing to purplish black.
• Stipe (Stem): 50 to 90 mm long by 1–3 mm thick. slightly thicker at the base, and sometimes twisted. A thin rudimentary cortina-like partial veil covers the gills when young, but disappears soon after the cap expands.
• Spore print: Dark purple-brown.

Microscopic Features

• Spores: 6.5–4–5.6 μm; rhomboid or nearly so in face view, and more or less ellipsoid when viewed from the side. Thick-walled, with a broad germ pore.
• Basidia: Four-spored; 12–22 by 5.5–9 μm, hyaline, roughly cylindrical or with a central constriction.
• Pleurocystidia: Abundant; 16–36 by 8–12 μm; ventricose, club-shaped or irregularly shaped.
• Cheilocystidia: Abundant; 19–35 by 4.4–6.6 μm, lageniform, narrowing into a long neck with a width of 1–3 μm, and either acute or somewhat capitate.

Ecology & Distribution

• Habitat: Among mosses in humus, or in muddy clay soils in subtropical coffee plantations and pasture edges.
• Range: Mexico, south to Argentina.
• Season: June and July in Mexico; in Argentina, it will fruit as early as February.

Phylogeny

• Section: Mexicanae.

ITS SEQUENCE:

TGTAGCTGGTCTTCGGATATGTGCTCGCCTGGTCATCTTTATCTATCCACCTGTGAACCATTTGTAGACTTGGGATTAGTGAAGGAGAGAGCAAGCTCTCTTTGAAGCTGTACCAGGCCTATGTTTTCATATACCCCAAAGTATGTAACAGAATGTGTTGTATGGCCTTGTGCCTATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATAAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTATTATTTGCTGGCTTATAGTCGGCTCCCCTCAAATGTATTAGCTGGTACCCTGCGCGGAACCGTCTATTAGTGTGATAATTATCTACGCTGTGGACATCTGCATTAATGGGATTGTACTGCTTCTAACAGTCCATTTATTGGACAATGCAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.