Psilocybe natalensis : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-400
Quantity
OUT OF STOCK
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Psilocybe natalensis

There has been quite a mix-up with this taxon in recent years. Samples had been widely traded, including on this website, of a species which had been collected in Natal and identified as P. natalensis. Ultimately, those samples were found to represent an entirely different taxon, and one completely new to science at that - Psilocybe ochraceocentrata. This isolate we now offer here is verified to be the original and true Psilocybe natalensis; a very large, unique and quite frankly beautiful species from South Africa.

Description

  • Pileus (Cap): 1, 4-6 cm in diameter; obtusely conic to hemispheric, then convex to broadly convex, sometimes with a little umbo; no traces of a veil in any stage, not hygrophaneus; irregular surface in some mushrooms, at first yellowish, particularly in the centre to whitish, then pure white in older fruit bodies, in this stage grey-blue lines at the margin possible, no further blueing after bruising or in the age.
  • Lamellae (Gills): Subdecurrent; buff, then dark purple-brown with a white edge.• Stipe (Stem): 4-12 x 0.2-1 cm, at first enlarged at the pileus, in mature specimens enlarged at the base; dry, smooth, shining, white, always curved, not flexuous, stuffed with white mycelia at first, later hollow, without any traces of a veil; no rhizomorphs on the base; easily staining blue-green when injured or touched, particularly on the base.
  • Spore print: Deep violet.

Microscopic Features

  • Spores: (10) 12-15 × (7) 8.5-9.4 um; broadly elliptic to ovoid; thick-walled, with a truncate germ pore.
  • Basidia: 24-32 × 9-11 um, clavate, hyaline, thin walled, usually 4-spored, some fruit bodies with a high proportion of abnormal monosporous, bisporous and trisporous basidia.
  • Pleurocystidia: Abundant or in some fruit bodies very rare; 18-40 x 10-15 um; clavate or lanceolate, with a mucronate, rostrate or papillate apex; sometimes ovate or obpyriform; hyaline; thin walled or very rarely with slightly thickened apex; sometimes capped with a small droplet of mucilage.
  • Cheilocystidia: Lageniform; 16-22 um long, with the enlarged base 5.5-8 um wide, and neck 3.5-6.0 um long, terminating in an obtuse, often slightly enlarged apex; hyaline; thin walled; sometimes capped with a small droplet of mucilage.

Ecology & Distribution

  • Habitat: Scattered in fertilized rich soil on pasture not on dung.
  • Range: Known only from type locality in Natal, South Africa.
  • Season: Summer (January in South Africa).

Phylogeny

  • Section: Cubensae


ITS SEQUENCE:

GGTTGTAGCTGGCCCTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACTTTTTGTAGATCATCGTTTTGGAAGCTGGATTGAAGTCGGAGAGGTCACTCTCTGATGAATTGAAGGCTTTCTCAATGGCGGTCTATGTTTTCATATACTCCAATGAATGTAACAGAATGTATCTATATGGCCTTGTGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTTCTTTTGCCGGCTTCTTACGAAGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTATAATGGGTTGAAGCTGCTTCTAACCGTCTGTTTAGTCAGACAATTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products