Welcome to The Spore Works

Since most species in the genus Psilocybe contain the same number of chromosomes (26), and many clades are descendant from a relatively recent common ancestor, inter-species hybridization is possible and occurs fairly readily. Our process of producing hybrids follows the 1981 patent filed by Gerlind Eger and Hermilo Leal Lara describing the mechanical dedikaryotization of basidiomycetes for the purpose of breeding cultivars.

Many hybrids have been attempted, and several have been successful. However, one particular cross between Psilocybe pseudoaztecorum and Psilocybe natalensis exhibited pronounced hybrid vigor and was extraordinarily robust. For the sake of convenience, we have designated it Psilocybe zinnii, named after the daughter of one of our technicians. Should the conversation lead to an official recognition of the species, more traditional naming conventions will be applied.

Several neohaplons (monokaryons) of each species were obtained through dedikaryotization and checked for clamp connections. The neohaplons were paired, plated together and incubated. Several produced obvious dikaryons which were excised and plated. After several days of growth, the dikaryons were verified to have clamp connections.

Most of the newly made dikaryons exhibited a slow growth habit, but one stood out from the rest, colonizing the agar quickly with every pass. One plate experienced an early bacterial contamination which the mycelium quickly and completely enveloped with no further issues.

The DNA of this strain was extracted, put through a PCR and the ITS region amplified for testing. DNA confirmed the unique genetic profile. We were surprised when we ran the sequence through ICBN BLAST to find another sequence from the same hybrid of species. However, a difference of two nucleotides separated our hybrid from the sample already uploaded to the databank.

ITS sequences of both parents and the resulting hybrid show the relationship between the three.

P. pseudoaztecorum:

ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTTGTTACATTCATTGGAGTATATGAAAACGTAGACCGCCATTGAGAAAGCTTTCAATTCATCAGAGAGAGACCTCTCCNACTTCAATCCAGCTTCCAAAACGATGATCTACAAAAAGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTT

P. natalensis:

GGTTGTAGCTGGCCCTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACTTTTTGTAGATCATCGTTTTGGAAGCTGGATTGAAGTCGGAGAGGTCACTCTCTGATGAATTGAAGGCTTTCTCAATGGCGGTCTATGTTTTCATATACTCCAATGAATGTAACAGAATGTATCTATATGGCCTTGTGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTTCTTTTGCCGGCTTCTTACGAAGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTATAATGGGTTGAAGCTGCTTCTAACCGTCTGTTTAGTCAGACAATTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA

P. pseudoaztecorum/natalensis hybrid (Psilocybe zinnii):

ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTGGTAC

Colonization of growth medium was rapid and complete, and fruiting took place within a week of full colonization. The unique-looking fruits were large, dense, plentiful and visually striking. Subsequent alkaloid testing revealed a surprisingly high percentage compared to Psilocybe cubensis samples.

Spore prints taken from the mature caps are heavy and spores germinate readily producing healthy mycelium.

We are proud to be able to offer this selection, Psilocybe zinnii, and encourage you to check back often. There are many more interesting things to come!