Welcome to The Spore Works
Spore Isolate Super Sale! - We're updating our inventory of supported Ps. cubensis ISO strains. - Close-out pricing - $10 each!
Spore Works Lab Monthly Feature - September 2026 : Psilocybe cubensis : Mr. Peanut Spore Isolate Syringe
European customers: shop directly through Sporeworks.EU, our European site shipping from Austria.
Orders over $100 receive $10 off! (shipping not included). Discount applied automatically at checkout.
Need suggestions? Check out the Bestsellers box for the most desired varieties in each category.
The Spore Works
Est. Oct 1998, purveyor of rare and exotic mushroom spores and cultures
Featured Products
MONTHLY FEATURE: Ps. cubensis : Mr. Peanut Spore Isolate Syringe
|
Strain Origin: Sporeworks laboratory California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions. |
$20.00
$17.00
15% OffPsilocybe cubensis : Golden Teacher Spore Syringe (MS)
|
Strain Origin: Unknown California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions. |
$20.00
Psilocybe cubensis : Penis Envy #6 PE6 Spore Syringe (MS)
|
Strain Origin: Varietal Hybrid of the Penis Envy and Texas Gulf Coast strains California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$20.00
3-Pack Isolate - Jedi Mind Fuck, Blue Meanie, Melmac (ISO)
|
Strain Origin: Various California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions. |
$60.00
$45.00
25% OffPsilocybe mexicana : Strain-X Spore Syringe (MS)
|
Origin: Xico, Mexico California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$30.00
Psilocybe ochraceocentrata : Natal Super Strain Spore Isolate Syringe
|
Strain Origin: Unknown California, Idaho, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$25.00
News
27
The Hybridization of Psilocybe Species - Psilocybe zinnii
Since most species in the genus Psilocybe contain the same number of chromosomes (26), and many clades are descendant from a relatively recent common ancestor, inter-species hybridization is possible and occurs fairly readily. Our process of producing hybrids follows the 1981 patent filed by Gerlind Eger and Hermilo Leal-Lara describing the mechanical dedikaryotization of basidiomycetes for the purpose of breeding cultivars.
Many hybrids have been attempted, and several have been successful. However, one particular cross between Psilocybe pseudoaztecorum and Psilocybe natalensis exhibited pronounced hybrid vigor and was extraordinarily robust. For the sake of convenience, we have designated it Psilocybe zinnii, named after the daughter of one of our technicians. Should the conversation lead to an official recognition of the species, more traditional naming conventions will be applied.

Several neohaplons (monokaryons) of each species were obtained through dedikaryotization and checked for clamp connections. The neohaplons were paired, plated together and incubated. Several produced obvious dikaryons which were excised and plated. After several days of growth, the dikaryons were verified to have clamp connections.
Most of the newly made dikaryons exhibited a slow growth habit, but one stood out from the rest, colonizing the agar quickly with every pass. One plate experienced an early bacterial contamination which the mycelium quickly and completely enveloped with no further issues.
The DNA of this strain was extracted, put through a PCR and the ITS region amplified for testing. DNA confirmed the unique genetic profile. We were surprised when we ran the sequence through NCBI BLAST to find another sequence from the same hybrid of species, provided in August of 2025 by Julian Mattucci of Imperial Scientific. A difference of two nucleotides separated our hybrid from the sample already uploaded to the databank.

ITS sequences of both parents and the resulting hybrid show the relationship between the three.
P. pseudoaztecorum:
ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTTGTTACATTCATTGGAGTATATGAAAACGTAGACCGCCATTGAGAAAGCTTTCAATTCATCAGAGAGAGACCTCTCCNACTTCAATCCAGCTTCCAAAACGATGATCTACAAAAAGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTT
P. natalensis:
GGTTGTAGCTGGCCCTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACTTTTTGTAGATCATCGTTTTGGAAGCTGGATTGAAGTCGGAGAGGTCACTCTCTGATGAATTGAAGGCTTTCTCAATGGCGGTCTATGTTTTCATATACTCCAATGAATGTAACAGAATGTATCTATATGGCCTTGTGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTTCTTTTGCCGGCTTCTTACGAAGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTATAATGGGTTGAAGCTGCTTCTAACCGTCTGTTTAGTCAGACAATTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA
P. pseudoaztecorum/natalensis hybrid (Psilocybe zinnii):
ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTGGTAC
Colonization of growth medium was rapid and complete, and fruiting took place within a week of full colonization. The unique-looking fruits were large, dense, plentiful and visually striking. Subsequent alkaloid testing revealed a surprisingly high percentage compared to Psilocybe cubensis samples.
Spore prints taken from the mature caps are heavy and spores germinate readily producing healthy mycelium.
We are proud to be able to offer this selection, Psilocybe zinnii, and encourage you to check back often. There are many more interesting things to come!

Products and service you can trust
Supplying rare and exotic mushroom spores since October of 1998. Focused on providing the highest quality and most desirable material. Our team takes pride in fast and friendly customer service and will do everything within our power to ensure 100% customer satisfaction.
Follow us on Bluesky - @sporeworks.com, Instagram - @sporeworking, TikTok - @official_sporeworks, and Vimeo
We are confident you will be satisfied with our high quality products and professional service.
We accept all major credit cards, cryptocurrency, and mail in payments. Shipping daily, Monday through Friday.
NOTE: Orders requesting Psilocybe Genera Spores to California, Idaho, Florida, and Georgia will be refused, voided, and refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.











