Psilocybe pseudoaztecorum : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. pseudoaztecorum

First described by Roger Heim in 1958 from collections in India, Psilocybe pseudoaztecorum was also later recorded in other tropical regions of Asia.

Description

• Cap (Pileus): 15–35 mm in diameter. Conical to convex, sometimes campanulate; does not usually expand widely. Reddish-brown to chestnut when moist; hygrophanous, fading to pale yellow-brown when dry. Smooth, viscid when fresh (due to pellicle).
• Gills (Lamellae): Adnate to adnexed. Pale brown when young, becoming dark purplish-brown with maturity; edges often whitish.
• Stipe (Stem): 40–70 mm long × 2–3 mm thick. Slender, hollow, fragile. Whitish to yellowish, sometimes reddish-brown toward the base. Lacks a persistent annulus. Bruises blue when handled.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Subrhomboid to ellipsoid; approx. 8–10 × 5–6 µm; thick-walled with a distinct germ pore.

Ecology & Distribution

• Habitat: Saprotrophic; grows on soil rich in organic debris, sometimes near grasses, and occasionally associated with decaying wood.
• Range: Described from India; later reported in Nepal, Bangladesh, and parts of Southeast Asia.
• Season: Fruits in warm, rainy periods (tropical wet season).

Phylogeny

• Section: Zapotecorum

ITS SEQUENCE:

ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTTGTTACATTCATTGGAGTATATGAAAACGTAGACCGCCATTGAGAAAGCTTTCAATTCATCAGAGAGAGACCTCTCCNACTTCAATCCAGCTTCCAAAACGATGATCTACAAAAAGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTT

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.