Psilocybe pseudoaztecorum : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. pseudoaztecorum

First described by Roger Heim in 1958 from collections in India, Psilocybe pseudoaztecorum was also later recorded in other tropical regions of Asia.

Description

• Cap (Pileus): 15–35 mm in diameter. Conical to convex, sometimes campanulate; does not usually expand widely. Reddish-brown to chestnut when moist; hygrophanous, fading to pale yellow-brown when dry. Smooth, viscid when fresh (due to pellicle).
• Gills (Lamellae): Adnate to adnexed. Pale brown when young, becoming dark purplish-brown with maturity; edges often whitish.
• Stipe (Stem): 40–70 mm long × 2–3 mm thick. Slender, hollow, fragile. Whitish to yellowish, sometimes reddish-brown toward the base. Lacks a persistent annulus. Bruises blue when handled.
• Spore Print: Dark purplish-brown.

Microscopic Features:

• Spores: Subellipsoid to sublentiform (lens-shaped) and are inequilateral in side view; approx. 8–10 × 5–6 µm; thick-walled with a distinct germ pore.
• Basidia: Predominantly 4-spored. Clavate (club-shaped).
• Pleurocystidia: 22–35 × 6–9 µm, lageniform with narrow neck (3–5 µm wide), abundant.
• Cheilocystidia: Utriform (urn-shaped) to broadly lageniform, 20 – 30 µm in length.

Ecology & Distribution

• Habitat: Saprotrophic; grows on soil rich in organic debris, sometimes near grasses, and occasionally associated with decaying wood.
• Range: Described from India; later reported in Nepal, Bangladesh, and parts of Southeast Asia.
• Season: Fruits in warm, rainy periods (tropical wet season).

Phylogeny

• Section: Zapotecorum

ITS SEQUENCE:

ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTTGTTACATTCATTGGAGTATATGAAAACGTAGACCGCCATTGAGAAAGCTTTCAATTCATCAGAGAGAGACCTCTCCNACTTCAATCCAGCTTCCAAAACGATGATCTACAAAAAGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.