Psilocybe samuiensis : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. samuiensis

A rare, psychoactive mushroom first described in 1993 from Koh Samui island, Thailand from a collection found growing on buffalo dung. It has subsequently also been collected in Cambodia.

Description

• Pileus (Cap): 7–15 mm diameter (very small). Conic to convex, sometimes with a slight umbo. Dark reddish-brown when moist, hygrophanous, drying to pale yellow-brown. Smooth, viscid when moist due to gelatinous pellicle.
• Lamellae (Gills): Adnate to adnexed. Initially light brown, maturing to dark purplish-brown with lighter edges.
• Stipe (Stem): 40-65 x 1.52 mm, equal or slightly subbulbous. It is hollow, white or whitish to pale straw color and covered with white fibrils. It is context concolorous with pileus, bluing with slightly farinaceous taste and odour.
• Spore Print: Dark purplish-brown.

Microscopic Features

• Spores: Ellipsoid to subellipsoid, inequilateral. Approx. 5.5-7.0 x 4.0-5.0 µm.
• Basidia: 4-spored.
• Pleurocystidia: Absent.
• Cheilocystidia: Lageniform (flask-shaped) to sublageniform, with an acute apex. 20-30 µm in length.

Ecology & Distribution

• Habitat: Coprophilous; grows directly on water buffalo dung in grassy fields.
• Range: First described in Koh Samui, Thailand, later reported from Cambodia and nearby regions of Southeast Asia.
• Season: Fruits during warm, rainy months.

Phylogeny

• Section: Mexicanae

ITS SEQUENCE:

TGGTTGTAGCTGGTTCTCTCGAGGACATGTGCTCACCTTGTCATCTTTATCTATCCACCTGTGAACTTTTTGTAGACTTGGAACTAGTGAATGGGAAAGCTTGCTTTCCTTGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGCTTCATTTTGCTGGCTTAGGTCGGCTCCCCTCAAATGCATTAGCTGGTACCCCGCGTGGAACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACATCTACATAAATGGGCTTGTACTGCTTCTAACCGTCCATTCACTGGACAATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.