Welcome to The Spore Works
BLACK FRIDAY SALE : Ultimate Syringe Collection : Ps. cubensis, one each of all current inventory (24 total) Psilocybe cubensis spore syringes @ 20% off! That's the whole enchilada, for $220, less than $10 per syringe!
Spore Syringe Three Packs! - Check out the new spore syringe three packs featuring our most popular and exciting mushroom spore combos. Now available:
- Spore Syringe Three Pack - Golden Teacher, Albino PE, B+
- Spore Syringe Three Pack - Penis Envy, PE Uncut, APE
- Spore Syringe Three Pack - Huautla, Oak Ridge, Treasure Coast
- Spore Syringe Three Pack - Colombian Rust, Ecuador, Corumba Brazil
- Spore Syringe Three Pack - ATL#7, Strain-A, Pollock
Spore Works Lab Monthly Feature - November 2024 : Psilocybe cubensis : McKennaii Spore Syringe.
Orders over $100 receive $10 off! (shipping not included). Discount applied automatically at checkout. Thanks for being awesome. We love our customers!
Need suggestions? Check out the Bestsellers box for the most desired varieties in each category.
Supplying rare and exotic mushroom spores since October of 1998. Focused on providing the highest quality and most desirable material. Our team takes pride in fast and friendly customer service and will do everything within our power to ensure 100% customer satisfaction.
The Spore Works
Est. Oct 1998, purveyor of rare and exotic mushroom spores and cultures
Featured Products
MONTHLY FEATURE: Psilocybe cubensis : McKennaii Spore Syringe
Named in honor of famed psychonaut and author Terrence McKenna, this variety's origins are uncertain. It arrived on the scene nearly twenty years ago and has remained a very popular variety in Europe and the US ever since. |
$17.00
Ultimate Syringe Collection : Ps. cubensis
Strain Origin: Various California, Idaho, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$275.00
$220.00
20% OffSpore Syringe Three Pack - Golden Teacher, Albino PE, B+
Strain Origin: Various California, Idaho, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$60.00
$45.00
25% OffPsilocybe cubensis : Golden Teacher Spore Syringe
Strain Origin: Unknown California, Idaho, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$20.00
Psilocybe cubensis : Tidal Wave Spore Syringe
Strain Origin: Unknown California, Idaho, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$20.00
Psilocybe aff. natalensis : Natal Super Strain Spore Syringe
Strain Origin: Unknown California, Idaho, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions. |
$25.00
News
25
Sequencing Fungal DNA @ Spore Works
Over the past decade, the increasing accessibility of DNA analysis tools has had a seismic effect on the phylogenetic tree of fungal species. Many species have been dissolved, moved, discovered and consolidated based solely on the sequence of nucleotides on a few genes on the periphery of their genome. A great example of the limits of microscopy in identifying fungal species lies in the story of a sample collected in Atlanta, GA in the 1990’s, which was identified as the then recently described Psilocybe atlantis. On further microscopic examination, it was found to be closer to Psilocybe galindoi, a species from the mountains of Mexico. Thus it stayed until DNA analysis revealed that the collection represented a population of the species Psilocybe tampanensis, before then only described from a single collection in the state of Florida. Subsequently, P. atlantis was destroyed as a species, and P. galindoi was absorbed into P. mexicana.
This saga represents the sample we currently offer known as ATL#7. Along with comparison tools like MycoMap and NCBI BLAST, on-demand Sanger sequencing services such as Genewiz have ensured that a science that was once relegated to academics in universities is now available to anyone with a rudimentary DNA extraction lab and PCR thermocycler. For under $500, and a basic knowledge of sterile technique, anyone can extract fungal DNA for professional analysis.While deep sequencing of an entire genome is possible with the right tools, and there are reasons to dive this far into the genetic maze of a fungal species, there are a handful of specific genes that are generally sequenced in order to tease apart species. The most commonly sequenced gene in fungi is called ITS - the Internal Transcribed Spacer gene, which is a specific section of DNA in the fungal genome that is highly variable, even among very closely related species.The process for identifying a species based on ITS goes like this:
- Clean mycelium or fruit body is ground in a lysis solution,
- Heated on a heat block,
- Centrifuged and decanted,
- Mixed with ITS primers and Taq polymerase,
- Thermocycled (PCR), and
- Sanger sequenced to determine order of nucleotides.
What you end up with is a large enough amount of the ITS region of DNA in the sample in order to get a clear and reproducible sequence. These samples can be either sequenced at home using a nanopore sequencer, or sent in to one of several on-demand sequencing companies for Sanger sequencing.New and exciting species are being discovered every day, and extracting DNA for sequencing is easy and fun! There are about 14,000 species of mushrooms known to science, and around 150,000 species of fungi described, while it is estimated that there are as many as 11,000,000 species of fungi living on Earth. Considering these numbers, the likelihood that you will encounter an undescribed species in your daily life is nearly a certainty. With just a few tools, and a little practice, you could introduce the world to an organism that has never before been described by science.Here are a few DNA sequences of the samples we offer here at Sporeworks:
GTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCCTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGAAACTGGATAGGAGAGGGACTTGTCCTTCAAGTTAAAGGTTTTTCGGCGCTCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATCTTATGGCTTTATGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTCTTTTGCCGGCTTCTCTCGAGATGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTCTCAATGGGTTGAAGCTGCTTCTAACCGTCCGTTCATTCGGACAGCACATAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
TTGACTTGGTTGTAGCTGGTCCTCTAGGGGACATGTGCTCGCCTTGTCATCTTTATCTATCCACCTGTGAACCTTTTGTAGACTTGGAACTAGTGAATGGGAGAGCATGCTCTCTTTGAAGCTATACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTTTCATTTGCTGGCTTCTGTCGGCTCCCCTCAAATGCATTAGCTGGTACCCCGCGCGGAGCCGTCTATTAGTGTGATAATTATCTACGCTGTGGACATCTGCATCAATGGGATTGTACTGCTTCTAACCGTCCATTTACTGGACAATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGC
AGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTCTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA
CGTGGTTGTAGCTGGCCCTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATTTCCACCTGTGCACTTTTTGTAGATCATTGTTTTTGGAAGTTGGATTGAAGTCAGAGAGTAATCTCTGATGAATTGAAGGCTTTCTCAATGGTGGTCTACGTTTTCATATACTCCAATGAATGTAACAGAATGTATCTATATGGCCTTGTGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTTTATTTTGCCGGCTTCTTACGAAGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTATTAATGGGTTGAAGCTGCTTCAAACCGTCTGTTTACTCAGACAATTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA
TGATTTGAGGTCAATGGTTCAAGTTGTCCCAATAACAGGACAGTTAGAAGCAGGGCAAACACCTTTTTACAGCAATCCTTAAACCCACGGCGTAGATAATTATCACACCAATAGATAGGTTTGCGCGGGGCACCCACTAATTCATTTGAGAGGAGCAGACTTTTGACAGCCTGCAGAAAACCTCCACATCCAAGCCATCATCACAAAAGTGATGAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCGTCGGAATACCAACGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCTAATGCCCATTGATTCGTTCTGTTACTTTCTATAGTGTATGTGTAAAAATACATAGGACCTGGGAATGAATGAAGCCGTTCAGAGAGTTACCTCCATTACAAGACTTCCCCCAGACCTACAGTGTGTGCACAGGTGGATAAACAAAAAAGGCAGATGCGTGCACAAAATTCCCCCGAGAGGGACAGCAACAGCTTCTACCTAGTTTATTCGATAATGATCCTTCCGCAGGTTCACCCTACGGA
Psilocybe subtropicalis (P. semperviva)
Happy Mushrooming!
-Sporeworks
Products and service you can trust
Follow us on Instagram - @sporeworks_official, Facebook - @official.sporeworks, and TikTok - @official.sporeworks
We are confident you will be satisfied with the high quality of our products and the speed and professionalism our service.
We accept all major credit cards, cryptocurrency, and mail in payments.
We are currently shipping daily, Monday through Friday. All orders will be dispatched within 3-5 days of payment, if not sooner.
NOTE: Orders requesting Psilocybe Genera Spores to California, Idaho, and Georgia will be refused, voided, and refunded. Possession of these mushroom spores may be illegal in CA, ID, and GA without the proper permissions.