Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. zapotecorum

A large psilocybin-containing mushroom first described by Roger Heim in 1956 from Oaxaca, Mexico, where it has been traditionally used in Zapotec rituals. It is the type species of section Zapotecorum,

Description

• Cap (Pileus): 20–100 mm diameter (can be quite large for a psilocybin mushroom). Conic to convex, expanding with age to broadly convex or nearly plane. Brown to yellow-brown when moist, strongly hygrophanous, fading to whitish, grayish, or pale straw when dry. Smooth, viscid when moist due to a separable gelatinous pellicle. Often undulating or irregular with age; translucent-striate when moist.
• Gills (Lamellae): Adnate to adnexed. Pale to brownish when young, turning dark purple-brown at maturity. Edges whitish due to sterile cells.
• Stipe (Stem): 80–200 mm long × 3–10 mm thick; robust compared to most Psilocybe. Whitish to yellowish or brownish, often darker toward base. Smooth to finely fibrillose. With conspicuous white rhizomorphs (rope-like mycelial strands). Strong blueing reaction when handled. No annulus.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Ellipsoid to subrhomboid, thick-walled with germ pore; typically 8–9.5 × 5–6 µm.

Ecology & Distribution

• Habitat: Saprotrophic; grows on rich soils in subtropical and tropical cloud forests, often near stream banks, landslides, or disturbed forest edges.
• Range: Widely distributed in Mexico, Central America, and South America (including Brazil, Colombia, Ecuador, Peru). Also occasionally reported from subtropical regions beyond Latin America.
• Season: Fruits during the rainy season, often in large, gregarious clusters.

Phylogeny

• Section: Zapotecorum (type species)

ITS SEQUENCE:

TGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTCTAGTCGGCTCCCCTCAAATGCATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.