Psilocybe zapotecorum : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. zapotecorum

A large psilocybin-containing mushroom first described by Roger Heim in 1956 from Oaxaca, Mexico, where it has been traditionally used in Zapotec rituals. It is the type species of section Zapotecorum,

Description

• Cap (Pileus): 20–100 mm diameter (can be quite large for a psilocybin mushroom). Conic to convex, expanding with age to broadly convex or nearly plane. Brown to yellow-brown when moist, strongly hygrophanous, fading to whitish, grayish, or pale straw when dry. Smooth, viscid when moist due to a separable gelatinous pellicle. Often undulating or irregular with age; translucent-striate when moist.
• Gills (Lamellae): Adnate to adnexed. Pale to brownish when young, turning dark purple-brown at maturity. Edges whitish due to sterile cells.
• Stipe (Stem): 80–200 mm long × 3–10 mm thick; robust compared to most Psilocybe. Whitish to yellowish or brownish, often darker toward base. Smooth to finely fibrillose. With conspicuous white rhizomorphs (rope-like mycelial strands). Strong blueing reaction when handled. No annulus.
• Spore Print: Dark purplish-brown.

Microscopic Features:

• Spores: Large, subrhomboid to subellipsoid, strongly inequilateral in side view. (10.5–)11.0–13.0(–14.0) × 6.5–8.0 µm. Smooth, thick-walled.
• Basidia: 20–28 × 7–9 µm, clavate. Mostly 2-spored, occasionally 4-spored.
• Pleurocystidia: 24–35(–40) × 6–10 µm, lageniform to subutriform, with narrow neck (3–5 µm wide), abundant.
• Cheilocystidia: 22–32 × 5–8 µm, similar to pleurocystidia, lageniform to utriform.

Ecology & Distribution

• Habitat: Saprotrophic; grows on rich soils in subtropical and tropical cloud forests, often near stream banks, landslides, or disturbed forest edges.
• Range: Widely distributed in Mexico, Central America, and South America (including Brazil, Colombia, Ecuador, Peru). Also occasionally reported from subtropical regions beyond Latin America.
• Season: Fruits during the rainy season, often in large, gregarious clusters.

Phylogeny

• Section: Zapotecorum (type species)

ITS SEQUENCE:

TGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTCTAGTCGGCTCCCCTCAAATGCATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.