Psilocybe yungensis : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. yungensis

Psilocybe yungensis is a psychoactive mushroom first described from the Yungas region of Bolivia, where it is found in subtropical and tropical cloud forests.

Description

• Pileus (Cap): 10–25 mm diameter. Conic to convex, sometimes with a prominent umbo. Reddish-brown to orange-brown when moist, strongly hygrophanous, fading to pale yellowish-brown when dry. Smooth, sometimes slightly viscid when moist. Margin often translucent-striate when wet.
• Lamellae (Gills): Adnate to adnexed. Light brown when young, becoming dark purple-brown at maturity, with whitish edges.
• Stipe (Stem): 30–60 mm long × 1–2 mm thick. Whitish to brownish, sometimes reddish-brown toward the base. Smooth or finely fibrillose; no annulus. Base with fine white mycelium; bruises blue when handled.
• Spore Print: Dark purplish-brown.

Microscopic Features

• Spores: Ellipsoid to subrhomboid, 5–6 by 4–6 μm.
• Basidia: 4-spored (though occasionally 2- or 3-spored forms may appear). Approx. 13-19 × 4.4-6.6 µm.
• Pleurocystidia: Ventricose (swollen) near the base and often mucronate (ending abruptly in a short sharp point) at the apex, and measure 14–25 by 4.4–10.5 μm.
• Cheilocystidia: Variable in shape, and measure 14–40 by 4.4–7.7 μm.

Ecology & Distribution

• Habitat: Saprotrophic; grows in groups on soil rich in woody debris or humus in tropical montane forests.
• Range: First described from the Yungas region in Bolivia; later reported from other parts of South and Central America, especially in cloud forest environments.
• Season: Fruits during rainy periods in humid subtropical climates.

Phylogeny

• Section: Cordisporae

ITS SEQUENCE:

GTGCTGGTCCTTTCGAGGACATGTGCATGCCTCGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGTTATAGTGAACGGGAGGGCATGCTCTCCTTGTAGCTATACTAAGCCTATGTTTTACATACCCCAAAGAATGTAATAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTGATAGCTTTTGCTGTTAATGGCTTGGATGTGGGGGTCTATTTTGCTGGCTTAGGTCGGCTCCCCTCAAATGTATTAGCCGGTACCCTGCGCGGAGCCGTCTATTAGTGTGATAATTATCTACGCTGTTAGACCTTTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTTGGACATATAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.