Psilocybe weraroa : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. weraroa

A fascinating and distinctive secotioid mushroom characterized by its closed, pouch-like form, striking olive-green to bluish colors, and potent bluing reaction. It is a species endemic to New Zealand's native forests.

Description

• Pileus (Cap): Smooth, slightly viscid (sticky) when moist. The color is highly distinctive: olive-green, often with bluish or greyish tones when young and fresh, maturing to a pale yellowish-brown or ochraceous as it ages or dries out. It exhibits a strong bluing reaction when handled or bruised. Typically subglobose (almost round) to pyriform (pear-shaped) or ovoid.
• Internal Structure: The interior contains a columella (a central column of sterile tissue) and convoluted, maze-like gill tissues (the gleba) that are pale brown, maturing to dark purplish-brown. The spore mass is contained within the sac-like peridium.
• Stipe (Stem): Very short, rudimentary, and often not clearly distinct from the spore-bearing head. The base may have white, cord-like rhizomorphs.
• Spore print: Dark purplish-brown.

Microscopic Features

• Spores: Ellipsoid to subellipsoid, inequilateral in side view. ~ 11.5 – 15.0 µm x 7.0 – 9.0 µm. Smooth wall and a distinct apical germ pore.
• Basidia: Four-spored, clavate.
• Pleurocystidia: Scattered to moderately abundant on the glebal folds. Fusoid-ventricose to lageniform (spindle-shaped with a swollen center tapering to both ends, or flask-shaped). 40 – 60 µm in length by 9 – 13 µm at the widest point. The tip is typically acute (pointed) or occasionally mucronate (ending in a short, sharp point).
• Cheilocystidia: Similar to Pleurocystidia.

Ecology & Distribution

• Habitat: Solitary or scattered in soil, often among mosses, leaf litter, and rotting wood in native forests, particularly those containing beech (Nothofagus) and other indigenous trees.
• Range: Found on both the North and South Islands of New Zealand, where it is endemic.
• Season: Autumn and early winter.

Phylogeny

• Section: Cyanescens.

ITS SEQUENCE:

CCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACATCTCGAGAGAAGCCGGCAAAAGACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCATAAAGCCATAAGATACATTCTGTTACATTCTTTGGGGTATATGAAAACATAGAACGCCGAAAAAAACCTTCAACTTGAAGGACAAGTCCCTCTCCTATCCAGTTTCAACGTCTACAAAAGGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTTCACCCTACGGA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.