Psilocybe papuana : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. papuana

A small, psychoactive mushroom containing psilocybin. It was originally described in 1978 by Guzmán and Horak from specimens collected in Papua New Guinea. It is one of several Australasian species of Psilocybe.

Description

• Cap (Pileus): Small, typically 10–20 mm diameter. Convex to campanulate (bell-shaped), sometimes with a small umbo. Brownish to reddish-brown when moist, hygrophanous, fading to pale yellow-brown as it dries. Smooth, sometimes slightly viscid when moist; margin often translucent-striate.
• Gills (Lamellae): Adnate to adnexed. Pale brown when young, maturing to dark purplish-brown. Edges often whitish from cystidia.
• Stipe (Stem): Slender, up to 40 mm long × 1–2 mm thick. Whitish to pale brown, sometimes with fibrillose texture. No annulus; base may show fine white mycelium. Bluing reaction when bruised.
• Spore Print: Dark purplish-brown.

Microscopic Features:

• Spores: Ellipsoid to subrhomboid; approx. 7.5 – 9.0 µm in length by 5.5 – 6.5 µm in width; thick-walled with distinct germ pore.
• Basidia: Clavate, 4-spored.
• Cheilocystidia: Present; utriform (urn-shaped) to broadly lageniform. 17 – 28 µm in length.
• Pleurocystidia: Absent (nullis) in the type material.

Ecology & Distribution

• Habitat: Saprotrophic; grows on soil rich in plant debris or among grasses; occasionally near dung.
• Range: Known from Papua New Guinea (type locality) and possibly nearby regions in Australasia.
• Season: Fruits during wet, humid periods.

Phylogeny

• Section: Semilanceatae

ITS SEQUENCE:

TTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.