Psilocybe papuana : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. papuana

A small, psychoactive mushroom containing psilocybin. It was originally described in 1978 by Guzmán and Horak from specimens collected in Papua New Guinea. It is one of several Australasian species of Psilocybe.

Description

• Cap (Pileus): Small, typically 10–20 mm diameter. Convex to campanulate (bell-shaped), sometimes with a small umbo. Brownish to reddish-brown when moist, hygrophanous, fading to pale yellow-brown as it dries. Smooth, sometimes slightly viscid when moist; margin often translucent-striate.
• Gills (Lamellae): Adnate to adnexed. Pale brown when young, maturing to dark purplish-brown. Edges often whitish from cystidia.
• Stipe (Stem): Slender, up to 40 mm long × 1–2 mm thick. Whitish to pale brown, sometimes with fibrillose texture. No annulus; base may show fine white mycelium. Bluing reaction when bruised.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Ellipsoid to subrhomboid; approx. 9–11 × 5–6 µm; thick-walled with distinct germ pore.

Ecology & Distribution

• Habitat: Saprotrophic; grows on soil rich in plant debris or among grasses; occasionally near dung.
• Range: Known from Papua New Guinea (type locality) and possibly nearby regions in Australasia.
• Season: Fruits during wet, humid periods.

Phylogeny

• Section: Semilanceata

ITS SEQUENCE:

TTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.