Psilocybe niveotropicalis : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. niveotropicalis

Psilocybe niveotropicalis is a recently described, wood-loving, bluing hallucinogenic mushroom discovered in South Florida in 2019. It's taxonomically placed near other tropical Psilocybe species, distinguished by its lighter cap coloration, unique spore morphology, and significant alkaloid content.

Description

• Cap: 20–45 mm diameter; convex to broadly umbonate, sometimes sharply umbonate in youth; Hygrophanous, smooth, oily sheen. Fresh colors range pale white to yellowish, drying to brownish or gray with a golden/orange umbo; Translucent striations at the margin reveal gill outlines when moist.
• Gills: Adnexed (narrowly attached), start pale rusty, maturing to dark purple-brown with lighter edges.
• Stipe (Stem): 15–55 mm long × 2–8 mm thick, slender, cylindric; whitish to sorrel-brown, bruises blue when handled. Prominent persistent annulus (ring) that often blues with age. Base with white rhizomorphs, sometimes embedded in substrate like a taproot.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): ~8.9–10.2 × 7–8.4 µm; Rhomboid in face view, with unusually high variability. Many show deep apical clefts or bifid shapes, a distinctive character uncommon in other Psilocybe.

Ecology & Distribution

• Habitat: Found in wood-chip mulch beds in irrigated, landscaped environments.
• Location: Described from South Florida (Jupiter area); season February–September.
• Natural habitat beyond landscaped settings remains unknown.

Phylogeny

• Section: Cubensae

ITS SEQUENCE:

CTACCTGATTTGAGGTCAATTGTCATTGTATTGTCCAAAAGGACGGTTAGAAGCAGCTTCAAAACCCATTGATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTTAGAAGCCGGCAAAAAAAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTTATAGGCACAAGGCCATATAGATACATTCTGTTACATTCTTGGGGTATATGAAAACATAGAGCGACCTTGAGAAAGCCTTCAACTCGAGAAAAAAAAGTGACTAGCAGCCTTTTCCTCTCCTATCCAACTTCCAACAAAGACGTCTACAAAAGGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTCCACCCTACGGAAG

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.