Psilocybe neoxalapensis : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-410
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. neoxalapensis

Originally described under the invalid name P. novoxalapensis in 2005, this species was validly published as Psilocybe neoxalapensis in 2009. It is a member of the Psilocybe fagicola complex, along with species like P. fagicola, P. oaxacana, P. banderillensis, P. columbiana, P. keralensis, P. herrerae, and P. teofiloi.

Description

  • Pileus (Cap): Conical to campanulate, typically featuring a prominent papilla (“nipple-like” structure). Caps range from 8 mm (small specimens) up to about 30 mm or slightly larger . Hygrophanous, moist caps are dark reddish-brown to chocolate-brown (sometimes with greenish-blue tinges), drying to a lighter yellow-brown or olive-brown. When moist, radial translucency highlights the gill positions.
  • Lamellae (Gills): Narrow and moderately crowded. Gill attachment ranges from adnexed to sinuate. Initially creamy, they darken to deep purple-brown as spores mature, often retaining lighter edges.
  • Stipe (Stem): Slender, measuring 30– mm long and 1–2 mm thick, often thickened toward the base. Stems are reddish-brown, paler near the apex, and frequently enveloped by floccose (woolly) whitish fibrils in the lower half. Most distinctive is the long whitish pseudorhiza (root-like mycelial extension) that may extend up to ~150 mm.
  • Annulus (Veil): A delicate, cobweb-like (cortinate) partial veil that typically vanishes early but may leave a faint annular zone on the stem, sometimes stained by spores.

Microscopic Features

  • Spores: (5–6) µm × 6.5–8.5 µm (with minimal values around 3.5 µm sometimes observed). Subellipsoid in side view; rhomboid in face view.
  • Basidia: 4-spored.
  • Cheilocystidia: Two distinct forms reported. Type A, narrowly lageniform (flask-shaped), often branched at the apex; (11-) 15-27 (-37) × (3-) 5-7 (-9) µm. Type B, subventricose to subcylindrical or utriform; (16-) 25-32 (-70) × (4-) 6-9 (-14) µm. These two cheilocystidial morphs are one of the diagnostic characters of the species.
  • Pleurocystidia: rare or absent; when present they are described as subventricose to subfusoide (sub-lageniform), (8-) 12-20 (-28) × (3-) 4-6 (-8) µm. The rarity/absence of pleurocystidia is noted as a distinguishing feature.

Ecology & Distribution

  • Habitat: Saprotrophic in mountain cloud forest ecosystems—typically in clay-rich soil along trail edges or forest embankments, at altitudes between approximately 1,240–3,491 m above sea level.
  • Geographical Distribution: Known from only about ten localities—seven in the State of Veracruz, Mexico, and three in central Costa Rica. Veracruz populations are in fragmented cloud forest patches near urban areas; the Costa Rican records are within protected regions.
  • Conservation Status: Proposed to be listed as Endangered (IUCN criterion A3c) due to vulnerability of its habitat, limited distribution, and threats from climate change and human disturbance—especially in Mexico, where predicted forest reduction could be around 68% over 60 years.

Phylogeny

  • Section: Zapotecorum, within the fagicola complex.

ITS SEQUENCE:

GCTTGGTTGTGCTGGTCCTCTCGAGGACATGTGCATGCCTTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGTTATAGTGAACGGGAGAGCGTGCTCTCCTTGAAGCTATGCTAGGCCTATGTTTTCATATACCCCAACGAATGTAATAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTAATAGCTTTTGCTGTTAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTATGTCGGCTCCCCTCAAATGTATTAGCCGGTACCCTGCGTGGCCGTCTATTAGTGTGATAATTATCTACGCTATTAGACCTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTGGACATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products