Psilocybe mescaleroensis : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. mescaleroensis

Formally described from New Mexico in 2007, near Mescalero in Lincoln County, USA, this species is only known to occur at the type location. Originally discovered and collected by mycologist Lee Walstad.

Description

• Pileus (Cap): 20–60 mm (i.e. 2.0 to 6.0 cm) and convex to subumbonate, often wavy, hygrophanous with a separable gelatinous pellicle, brownish-yellow to pale brown-yellow, often more orange at the center.
• Lamellaw (Gills): Adnate to adnexed, cream colored, darkening to pale brown-gray or brown-rose, then finally dark chocolate brown.
• Stipe (Stem): (50-) 60-70 (-100) mm long × 5-8 (-20) mm thick, cylindrical, equal or slightly thicker toward the apex, sometimes flexuous (slightly bent). Fibrillose (fibrous), whitish, sometimes with light orange or orangish-pink patches, bruising blue when handled. A fragile, membranous annulus is often present but ephemeral.
• Spore print: Dark chocolate brown.

Microscopic Features

• Spores: Approx (9-) 10-11 (-13) × 6-7 (-8) µm. Shape sub-rhomboid to subovoid in face view; subovoid in side view. Thick-walled, up to ~1 µm.
• Basidia: 4-spored, hyaline, ~35-39 × 7.5-9 µm, subclavate.
• Pleurocystidia: Absent.
• Cheilocystidia: ~20–30 × ~6 µm, fusiform or ventricose-rostrate, sometimes forked.

Ecology & Distribution

• Habitat: Found on dead grasses or decaying grasses and grassland soil; also on rich, well-drained soil with grass litter. Often in grasslands and savanna near Ponderosa pine (Pinus ponderosa) woodlands. Associated with gopher holes.
• Range: Only known from type location, Sierra Blanca Range, Lincoln County, near Mescalero, New Mexico.
• Season: Summer and fall, holotype was collected in July.

Phylogeny

• Section: Stuntzae

ITS SEQUENCE:

GATTTGAGGTCAATTGTCATTATGTGCTGTCCGAATGAACGGACGGTTAGAAGCAGCTTTTAAAACCCATTGATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCAAATGAAGCCGGCAAAAGACCCCCAAATCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCATATGATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGACCGCTTGAGAAAAAGACCTTCAACTCTGGGAGGGCCGTGAAGCTTC

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.