Psilocybe stuntzii : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. stuntzii

Known colloquially as the ‘blue ringer’, Psilocybe stuntzii was described in 1978 by Gastón Guzmán and Jonathan Ott, named in honor of Daniel Stuntz, a University of Washington mycologist who contributed greatly to agaric taxonomy. It is a psilocybin-containing mushroom native to the Pacific Northwest (USA and Canada) and is closely related to P. fimetaria and P. subfimetaria.

It belongs to section Stuntzae, a group characterized by viscid caps, presence of a partial veil (ring), and coprophilous or grassy-soil habitats.

Description

• Pileus (Cap): 15–40 mm diameter. Convex to broadly convex, sometimes nearly plane with age. Chestnut brown to yellowish-brown when moist; hygrophanous, fading to pale yellow or straw when dry. Smooth, viscid when fresh (due to gelatinous pellicle). Margin even, sometimes faintly striate when moist.
• Lamellae (Gills): Adnate to adnexed. Pale grayish-brown when young, darkening to purplish-brown with maturity. Edges whitish, often contrasting with gill faces.
• Stipe (Stem): 40–80 mm long × 2–4 mm thick Whitish to yellowish, often bruising blue-green at handling points. Smooth to fibrillose, sometimes pruinose near apex. Partial veil thin, forming a fleeting annulus or ring zone.
• Spore Print: Dark purplish-brown.

Microscopic Features

• Spores: 8.2–13.5 x (6) 7.1–7.7 x 5.5–6.6 μm, subrhomboid in face view, subellipsoid in side view, with a hilar appendage visible and a truncate apex with a broad germ pore, thick walled, and dingy yellow brown.
• Basidia: 4-spored, hyaline.
• Cheilocystidia: 22–30 x 4.4–6.6 μm, abundant, forming a sterile band, hyaline, lageniform, fusiform-lanceolate or fusoid-ampullaceous, with an elongate and flexuous neck, and are 1–2.2 μm in diameter, sometimes irregularly branched.
• Pleurocystidia: Absent.

Ecology & Distribution

• Habitat: Saprotrophic; grows in soil rich with woody debris, mulch, and grass, and occasionally in lawns and pastures. Not strictly coprophilous but often associated with disturbed, nutrient-rich ground.
• Range: Pacific Northwest – Oregon, Washington, British Columbia.
• Season: Fruits in autumn through early winter, especially after rains.

Phylogeny

• Section: stuntzae

ITS SEQUENCE:

CAAATTGTCATTTGTATTGTCCAAACGAAGGAACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGCCCACGGCGTAGATAATTATCACACCAATAGACGGCTTTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAACTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTTGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGGGACACGGCGAGCACATGTCCTCGAGAGGACCAGCTACAACCGAGCCAAGTTTATTCCAATAATGATCCTTTCCGCAGGTTCCCCCTACGGAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.