Psilocybe subaeruginascens : MycoTrue(TM) Isolate Vial
Description
|
Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price! MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories. Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below P. subaeruginascens Psilocybe subaeruginascens is a tropical dung-loving species, closely related to, and resembling the North American P. ovoideocystidiata, which thrives on woody debris and in wood chip piles throughout the Ohio River valley. Adding some mystery into the mix, it is reported to be found in southern Japan growing uncharacteristically from wood. Because of this and several other inconsistencies, Gaston Guzman considered the Japanese collections to represent another related taxon: P. Septentrionalis. Description
Microscopic Features
Ecology & Distribution
Phylogeny
ITS SEQUENCE: AATTGTCATTGTATTGTCCCTAAGGACGGTTAGAAGCAGCTTCAAAACCCATTGATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACCTCGTTAGAAGCCGGCACAAAACCCCCAACTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTTATAGGCACAAGGCCATATAGATACATTCTGTTACATTCTTGGGGTATATGAAAACATAGAGCGACCTTGAGAAAGCCTTCAACTCGAGAAAAAGTGAACTAGCACCCTTTCTCTCCTATTCAGCTTCCAACAAAGACGTCTACAAAAGGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAG HOW TO UTILIZE MYCOTRUE VIALS - (see video below)
* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations. California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions. |











