Psilocybe subaeruginascens : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-6751
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. subaeruginascens

Psilocybe subaeruginascens is a tropical dung-loving species, closely related to, and resembling the North American P. ovoideocystidiata, which thrives on woody debris and in wood chip piles throughout the Ohio River valley. Adding some mystery into the mix, it is reported to be found in southern Japan growing uncharacteristically from wood. Because of this and several other inconsistencies, Gaston Guzman considered the Japanese collections to represent another related taxon: P. Septentrionalis.

Description

  • Pileus (Cap): 20 - 30 mm diam., broadly and obtusely campanulate, ivory or pale greyargillaceous, at disc with blue-green tinge, smooth, dry, veil remnants absent.
  • Lamellae (Gills): 16-24 mm reaching stipe, lamellulae in 5 - 7 series, broadly adnate, at first pale brown, becoming fuscous in old specimens, fimbriate edges whitish.
  • Stipe (Stem): 4 0 - 6 5 x 2 - 3 mm. cylindrical, equal, white, turning blue-green upon handling, dry, hollow, rather tough, smooth to slightly fibrillose, base with conspicuous white rhizoids and mycelial strands attached to substrate, solitary. Ring fragile and nonpersisting, membranaceous, non-striate, hanging, white.
  • Spore Print: Dark brown to black.

Microscopic Features

  • Spores:8-9.5x5 - 6.5 x 4.5 - 5.5 um, elliptical to subrhomboid in face view, amygdaliformin side view, thick-walled (1-1.3 um diam.), with distinctive apical germ pore, smooth, opaque.
  • Basidia: 24-30x6-8 um, cylindrical or constricted-suburniform, 4-spored, sterigmata up to 7 um long.
  • Cheilocystidia: 22–30 x 4.4–6.6 μm, abundant, forming a sterile band, hyaline, lageniform, fusiform-lanceolate or fusoid-ampullaceous, with an elongate and flexuous neck, and are 1–2.2 μm in diameter, sometimes irregularly branched.
  • Pleurocystidia: Absent.
  • Cheilocystidia: 18 - 24 x 6 - 10 um, polymorphic, shape ranging from fusoid to subutriform, thin-walled, hyaline, apex rounded or subcapitate, occasionally covered with thin, hyaline incrustation

Ecology & Distribution

  • Habitat: On horse manure (type) or on soil among litter, in tropical-lowland broadleaf forest. On elephant dung in India. Also reported from woody debris and chip piles in Japan, though this may represent a separate species.
  • Range: Indonesia, southern Japan and Kerala state in India.
  • Season: April to July.

Phylogeny

  • Section: Cubensae

ITS SEQUENCE:

AATTGTCATTGTATTGTCCCTAAGGACGGTTAGAAGCAGCTTCAAAACCCATTGATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACCTCGTTAGAAGCCGGCACAAAACCCCCAACTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTTATAGGCACAAGGCCATATAGATACATTCTGTTACATTCTTGGGGTATATGAAAACATAGAGCGACCTTGAGAAAGCCTTCAACTCGAGAAAAAGTGAACTAGCACCCTTTCTCTCCTATTCAGCTTCCAACAAAGACGTCTACAAAAGGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAG

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products