Psilocybe tasmaniana : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-750
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Psilocybe tasmaniana

Psilocybe tasmaniana is a rare, psychoactive mushroom originally described from Tasmania and also reported from southeastern Australia and New Zealand.

Description

  • Cap (Pileus): Small, 10–20 mm in diameter, convex to subcampanulate (domed to somewhat bell-shaped), without umbo or papilla. The surface is glabrous apart from whitish flecks of veil remnants at the margin. It is slightly striate at the margin when moist, feels a little tacky or sticky, and is hygrophanous, changing colour abruptly from wet to dry. Coloured tawny orange, drying dull or ochraceous straw.
  • Gills (Lamellae): Adnate (broadly attached) to slightly sinuate (notched), moderately crowded. The color is initially pale brown, maturing to a dark purplish-brown with whitish, fimbriate (fringed) edges.
  • Stipe (Stem): 20-50 mm long, 1-3 mm thick, cylindrical, fragile, and hollow. The surface is whitish to pale brown, often with fine white fibrils, especially towards the apex. It typically exhibits a weak to moderate bluing reaction, especially at the base when handled or damaged.
  • Spore Print: Dark purplish-brown.

Microscopic Features

  • Spores: 12-13 x 7.1-7.7 μm, ellipsoid or subellipsoid to subovate in shape and dark brownish yellow. Thick-walled, broad apical germ pore (situated at one end).
  • Basidia: 4-spored, transparent and subcylindric, measuring 22-33 x 5.5-9.9 μm.
  • Pleurocystidia: Around 19-24 × 6.6-8.8 µm, “abundant” in some descriptions. Fusoid-ventricose (tapered toward ends, distinctly swollen in the middle), with short necks (~1.6-2.8 µm).
  • Cheilocystidia: 22-23 × 4.4-9.9 µm, Fusoid-ventricose, globose-ventricose, or sublageniform; many have long necks (5-11 × 1.6-3.3 µm) Some cheilocystidia show bifurcation (branching) and others have a transparent swollen drop at the tip.

Ecology & Distribution

  • Habitat: Saprotrophic; grows on dung (notably of marsupials and cattle) and in rich grassy soils.
  • Distribution: Documented from Tasmania, southeastern Australia, and New Zealand.
  • Season: Fruits in cooler, wetter months (austral autumn to early winter).

Phylogeny

  • Section: Semilanceata

ITS SEQUENCE:

TTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTAACGAAGCCAGCAAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTTGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAATTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCTCTAGAGGACCAGCTGCAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCCTACGGAAG

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products