Psilocybe tasmaniana : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. tasmaniana

Psilocybe tasmaniana is a rare, psychoactive mushroom originally described from Tasmania and also reported from southeastern Australia and New Zealand.

Description

• Cap (Pileus): Small, usually 10–20 mm across. Convex to campanulate (bell-shaped), sometimes with a slight umbo. Smooth, hygrophanous, brown to yellow-brown when moist, drying to pale yellowish. Margin often translucent-striate when moist.
• Gills (Lamellae): Adnate to adnexed. Initially pale brown, darkening to purplish-brown with maturity. Edges often whitish.
• Stipe (Stem): Slender, up to 40 mm long, whitish to pale brown. Fibrillose, sometimes slightly enlarged at the base. Lacks a persistent annulus. Bruises blue when handled.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Ellipsoid to subrhomboid, thick-walled, with a distinct germ pore; approx. 11–13 × 6–7 µm.

Ecology & Distribution

• Habitat: Saprotrophic; grows on dung (notably of marsupials and cattle) and in rich grassy soils.
• Distribution: Documented from Tasmania, southeastern Australia, and New Zealand.
• Season: Fruits in cooler, wetter months (austral autumn to early winter).

Phylogeny

• Section: Semilanceata

ITS SEQUENCE:

TTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTAACGAAGCCAGCAAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTTGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAATTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCTCTAGAGGACCAGCTGCAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCCTACGGAAG1

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.