Psilocybe serbica : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. serbica

Described by Meinhard Moser & Egon Horak in 1969, Psilocybe serbica is a dainty but prolific species can be found throughout central Europe. Once split into a number of distinct species, P. bohemica, P. moravica, P. arcana were all found to be conspecific. More recent DNA analysis has found that Psilocybe mairei, a species found in north Africa and depicted in cave paintings at Tassili n'Ajjer in Algeria dating to 8000BC, is also conspecific with P. serbica.

Description

• Pileus (Cap): 1–4(5) cm diameter. Starts obtusely conical, becoming bell-shaped (campanulate) or convex, then broadly convex to nearly flat with maturity. Margin often incurved when young, later plane or slightly decurved. Buff-brown to dirty orange-brown when moist; pale ochraceous or straw/ochre when dry. The center sometimes darker. Slight translucently striate margin when moist. Hygrophanous. Not viscid; there is no separable gelatinous pellicle.
• Lamellae (Gills): Adnate to adnexed; often subdecurrent in some specimens. Gills close, initially light brown, becoming dark brown with a purplish tint as spores mature. Edges remain paler.
• Stipe (Stem): 4.5-8 (up to ~10) cm long; thickness about 2-10 mm. More or less equal, sometimes slightly enlarged at base. Color whitish, silky/glossy; base often with white mycelial/fibrillose remnants. Partial veil (cortinate or fibrillose) present in young specimens, often quickly vanishing.
• Spore Print: Dark purple-brown.

Microscopic Features

• Spores: ~10-13 × 6-7.5 µm. Some specimens show longer spores beyond that range. Ellipsoid, slightly flattened in some views; thick-walled; with a distinct germ pore.
• Basidia: Typically four-spored.
• Pleurocystidia: Absent or rare. When present, usually near the gill edge. Size reported for rare ones: ~16-25 × 4.4-7.7 µm
• Cheilocystidia: Present; bottle- to flask-shaped, with elongated necks in many specimens; size ~20-36 × 6-11 µm in some sources.

Ecology & Distribution

• Habitat: Well-decayed deciduous and coniferous wood, compost, plant debris, twigs. Often forest-floor debris, pathsides, moist environments (along creeks, shaded wet spots).
• Range: Common throughout central Europe (Czech Republic, Slovakia, Serbia, etc.)
• Season: Late summer to autumn (roughly June through November depending on climate).

Phylogeny

• Section: Cordisporae

ITS SEQUENCE:

TGTAGCTGGCCCTCTCGGGGGCATGTGCCCACCATGTCATCTTTATATCTCCACCTGTGCACCCTTTGTAGAACGTTTTTGGACTGATAGGAGGGGCTCGAAAGAGTTTCCAAGTTGAACGTCCTGAACGGTCTACGTTTTCATATACCCCAAAGAATGTAATAGAATGTATCATATGGCCCAGTGCCTATAAACTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAA TCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTCGTGTAATGGCTTGGACTTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCAGCTCCCCTTAAATGCATTAGCCGGCTTCCCTGCGTGGACCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACAATCTGCTTTAATGGGTTGAAGCTGCTTCTAACCGTCCGTTAAGTTGGACAATACATATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.