Psilocybe medullosa : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. medullosa

Psilocybe medullosa is a European species, closely related to and resembling the North American P. silvatica, was first described as Naucoria medullosa in 1898 by Italian mycologist Giacomo Bresadola, then moved to the genus Psilocybe in 2007 by Jan Borovicka.

Description

• Pileus (Cap): 1–2 cm, conical–campanulate, striate; epicuticular pellicle slightly viscid but not separable; reddish brown with paler margin; not distinctly hygrophanous but fading with age. Sparse, fleeting veil at the margin in younger specimens.
• Lamellaw (Gills): Moderately crowded, with lamellulae, somewhat ascending but with adnate attachment; light brown with white edges.
• Stipe (Stem): 5–8 x 0.2–0.3 cm, central, cylindrical, hollow, slightly sinuous; light brownish with a paler apex; in the lower three-quarters covered with conspicuous white velar fibrils; base with shaggy mycelium.
• Spore print: Purple-brown.

Microscopic Features

• Spores: 8–11 x 4.5–5.5 μm, ellipsoid–oblong in frontal view, flattened adaxially or subamygdaliform in side view; smooth, with slightly thickened wall and a small distinct germ pore; yellowish-brownish in water; unchanged or only imperceptibly darker in Melzer’s reagent (indistinguishably dextrinoid).
• Basidia: 4-spored.
• Pleurocystidia: Absent.
• Cheilocystidia: Numerous, 25–40 Å~ 8–9(12) μm, lageniform with generally narrow and long neck, straight or sinuous.

Ecology & Distribution

• Habitat: Among moss and leaf-littler in coniferous woodland.
• Range: Europe; northern Italy to the Baltics and western Russia.
• Season: Late summer to early fall. Original collection made in September.

Phylogeny

• Section: Semilanceatae

ITS SEQUENCE:

AACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTTGGCCGTCCGAGTTGTAATCTAGAGAAGTGTTATCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCGGGGATCAACCTTGCTTTTGCTGGGTGTACTTTCCGGTCGACGGGTCAGCATCAATTTTGACCGTTGGATAAAGTGTGAGGGAATGTGGCATCCTCGGATGTGTTATAGCCCTTGCTCGCATACAACGATTGGGATTGAGGAACTCAGCACGCCGAAAGGCCGGGTACTTGTACCACGTTCGTGCTTAGGATGCTGGCATAATGGCTTT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.