Psilocybe indica : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. indica

A rare psychoactive mushroom described from India in 1993 by mycologist Gastón Guzmán and colleagues. Psilocybe indica is one of the few Psilocybe formally documented from the Indian subcontinent. It is possible that this species is conspecific with Psilocybe chuxiongensis from tropical China.

Description

• Cap (Pileus): Small, about 10–20 mm in diameter. Convex to campanulate (bell-shaped). Brownish to yellowish, hygrophanous (changes color as it dries). Smooth surface, often with translucent striations when moist.
• Gills (Lamellae): Adnate to adnexed attachment. Start pale brown, becoming dark purplish-brown at maturity. Edges lighter than gill faces.
• Stipe (Stem): Slender, up to 30–40 mm long. Whitish to pale brown, smooth or slightly fibrillose. May show bluing reaction when bruised. Lacks a persistent annulus.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Ellipsoid, thick-walled with a germ pore; approx. 9–11 × 5–6 µm.

Ecology & Distribution

• Habitat: Grows on soil enriched with organic matter, sometimes near grasses or dung.
• Distribution: Described from India; known only from limited collections, making it a rarely observed species.
• Season: Fruits during monsoon and post-monsoon months when moisture is high.

Phylogeny

• Section: Caerulescentes

ITS SEQUENCE:

ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTGTTACATTCATTGGAGTATATGAAAACGTAGACCGCCATTGAGAAAGCTTTCAATTCATCAGAGAGAGACCTCTCCGACTTCAATCCAGCTTCCAAAACGATGATCTACAAAAAGTGCACAGGTGGAGATATAAAGATGACGGGCGAGCACATGCCCCCGAGAGGGCCAGCTACAACCACGCCAAAGTTATTCAATAATGATCCTTCCGCAGGTTCACCTACGGAA

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.