Psilocybe caeruleorhiza : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-200
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. caeruleorhiza

Known by the common name “winter teacher”, Psilocybe caeruleorhiza is a newly described psilocybin-containing mushroom species native to North America and is closely related to P. serbica (Europe) and P. aztecorum (North America). The species name, meaning “blue root” was inspired by the strong blueing reaction of rhizomorphs in culture.

Description

  • Cap: Convex or umbonate, hygrophanous, brownish-tantypical of many Psilocybe species.
  • Gills: Adnate or sinuate. Color transitions from light brown to dark purplish-brown as spores mature
  • Partial Veil: Thin and subcortinate, but does not leave an annulus, which is an important field distinction from similar species.
  • Stipe (Stem): Slender, variable in length (typically a few centimeters long, proportionate to the cap), with a relatively narrow diameter. Whitish to pale brownish, sometimes darker toward the base. Smooth to slightly fibrillose; no persistent annulus (ring). Often attached to rhizomorphic mycelium, which bruises blue.
  • Spores (Microscopic): (10.2) 10.9–12.1–13.2 (15.1) × (5.5) 5.9–6.4–7.1 (7.9) µm. ellipsoid to subellipsoid to slightly asymmetrical (“mango-shaped” per Guzmán), thick-walled, walls ≥0.5–<1.0 µm with an apical germ pore, dark to medium brown.
  • Similar Species: Psilocybe ovoideocystidiata may be confused with P. caeruleorhiza, but it possesses a thin annulus and fruits earlier in the spring and early summer, while P. caeruleorhiza fruits later in the season.

Microscopic Features:

  • Spores: (10.2) 10.9–12.1–13.2 (15.1) × (5.5) 5.9–6.4–7.1 (7.9) µm. ellipsoid to subellipsoid to slightly asymmetrical, thick-walled, walls ≥0.5–<1.0 µm with an apical germ pore, dark to medium brown.
  • Basidia: 20–30 × 6–8 µm, clavate (club-shaped), 4-spored.
  • Cheilocystidia: Abundant. Lageniform (flask-shaped) to fusiform, sometimes with elongated necks. 20–30 × 5–8 µm.
  • Pleurocystidia: Very rare to nearly absent, appearing like the shorter, ventricose cheilocystidial elements.

Ecology & Distribution

  • Native Range: Eastern and Midwestern United States. Documented occurrences include Indiana, Iowa, Kentucky, Michigan, Missouri, and Pennsylvania.
  • Substrate: Saprotrophic, typically found in man-made mulch beds, indicating an affinity for anthropogenic environments.
  • Fruiting Period: Late fall through early winter, especially October to January, with a peak in December.

Phylogeny

  • Section: Aztecorum

ITS SEQUENCE:

TGCTCCTGGTCATCGTGATTTYATCAAGAACATGATCACCGGTACTTCCCAGGCTGATTGTGCTATCCTCATCATTGCYGGAGGAACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCTCTCCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTAAATTCGAGATCAAAACCTTACATTTTACAGTCTCTAATTAATTTCTCTTATTAGTGGTCCGAGGATCGTTTCAACGAAATTATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGATGGCAYGGAGACAACATGTTGGAGGAGTCCGTCAAGTATGTTTTTTTATTACTTTATCTTATCGCTCCAATTCTCATATATTATTCTTTCTTCAGCATGCCCTGGTTCAAGGGTTGGTCTCGTGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACCCTCCTCGATGCCATCGATGCCATCGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products