Psilocybe caeruleorhiza : MycoTrue(TM) Isolate Vial
Description
|
Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price! MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories. Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below P. caeruleorhiza Known by the common name “winter teacher”, Psilocybe caeruleorhiza is a newly described psilocybin-containing mushroom species native to North America and is closely related to P. serbica (Europe) and P. aztecorum (North America). The species name, meaning “blue root” was inspired by the strong blueing reaction of rhizomorphs in culture. Description
Microscopic Features:
Ecology & Distribution
Phylogeny
ITS SEQUENCE:
TGCTCCTGGTCATCGTGATTTYATCAAGAACATGATCACCGGTACTTCCCAGGCTGATTGTGCTATCCTCATCATTGCYGGAGGAACCGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACCCGCGAGCACGCTCTCCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTCGCCGTCAACAAGATGGACACCACCAAGGTAAATTCGAGATCAAAACCTTACATTTTACAGTCTCTAATTAATTTCTCTTATTAGTGGTCCGAGGATCGTTTCAACGAAATTATCAAGGAGACTTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCCATCTCCGGATGGCAYGGAGACAACATGTTGGAGGAGTCCGTCAAGTATGTTTTTTTATTACTTTATCTTATCGCTCCAATTCTCATATATTATTCTTTCTTCAGCATGCCCTGGTTCAAGGGTTGGTCTCGTGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACCCTCCTCGATGCCATCGATGCCATCGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGT HOW TO UTILIZE MYCOTRUE VIALS - (see video below)
* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations. California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions. |

Psilocybe caeruleorhiza : MycoTrue(TM) Isolate Vial

Psilocybe caeruleorhiza bluing reaction in mycelium

Psilocybe caeruleorhiza bluing reaction in rhizomorphs

Psilocybe caeruleorhiza bluing in mycelium









