Psilocybe aztecorum : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-185
Quantity
OUT OF STOCK
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regalar price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Psilocybe aztecorum

Psilocybe aztecorum has the most storied recorded history of any of the species in the genus. In the 16th century, the Spanish friar Bernardino de Sahagún recorded in his manuscript “Historia general de las cosas de la Nueva España,” or “General History of the Things of New Spain,” the ritual consumption of this species by the Nahua people in Tenochtitlan, calling it Teonanacatl (teotl meaning something like sacred animus, nacatl meaning flesh). It is still used today in much the same way by several central-Mexican peoples. Once thought to be endemic to central Mexico, it has subsequently been collected throughout the mountainous areas of the American west, and the species P. quebecensis named for the Canadian province of Quebec where it was originally found, was determined by genetic analysis to be the same species.

Description

  • Pileus (Cap): 1 to 2.5 cm in diam., irregularly rounded, not mammiform, sometimes slightly umbonate, asymmetric, margin with deep clefts to invo-lute, then incurved, not striate; glabrous, slightly hygrophanous, extremely pale ochra-ceous, slightly more brown at the apex, subtle grey and green staining where damaged, greyish blue green on the edges.
  • Lamellae (Gills): Not very close, narrow, edge irregularly depressed, purplish violet, with white edges.
  • Stipe (Stem): Long, often thin, 3–6 cm, irregular, curved, sinuous, very fibrous, twisted, uniform, uneven, often with a swollen base and sometimes in the upper part (2–4 mm) greenish yellow sporadically, sometimes grey-blue-green, dark brown to olivaceous brown, sepia to the base, compact. Context thin, greyish white, but not pellicular in the pileus, guaiacol unchanged, taste astringent, odour like new flour.
  • Spore print: Purple-brown.

Microscopic Features

  • Spores: Ellipsoid elongated, 10.5–14 Å~ 6–7.25 Å~ 6–7.5 μm, ochraceous brown, markedly pale. Germ pore broad.
  • Basidia: 24–33 by 6.6–8.8 μm, 1-4-spored, 4 being most common.
  • Pleurocystidia: (16–)18–40(–47)(–54) Å~ 4–8(–10) μm, lageniform, rostrate or with long neck, sometimes bifurcate, thin-walled, hyaline, sometimes with encrusted pigment at the base, abundant; apex obtuse.
  • Cheilocystidia: (11–)(13.5–)17–48(–59) Å~ (3–)4–9(–11)(–14) μm, lageniform or narrowly fusiform, rostrate or with long neck, sometimes bifurcate, thin-walled, hyaline; apex obtuse.

Ecology & Distribution

  • Habitat: Gregarious or scattered, occasionally caespitose, growing on woody debris, on twigs, on rotten pine-cones or on rotten pine logs. In Mexico, it grows only at high

    elevations between 2000–4000 m a.s.l. in open forests of Pinus hartwegii, in P. montezumae and Abies religiosa forests or in Pinus-Quercus forests. In Canada grows in Abies-Betula forests with Alnus and Picea.

  • Range: Central Mexico, Arizona, California, Oregon, Colorado, Michigan, the provinces of Quebec and Nova Scotia in Canada, Costa Rica, and possibly India.
  • Season: August to October.

Phylogeny

  • Section: Type species of section Aztecorum


ITS SEQUENCE:

TTGTCATATGTATTGTCCAACTTAATAGACGGTTAGAAGCAGCTTCAACCCATTAAAGCAGATTGTCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACGCGGGGAAGCCGGCTAATGCATTTAAGGGGAGTTGACCTCTTGACGAAGCCAGCAAAAGACCCCCAAGTCCAAGCCATTACACGAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATTTAGTTTATAGGCACTAGGCCATATGATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGACCGTTCAGGACGTTCAACTTGGTCAACTCTTGCGAGTCTCACTCCTATCAGTCCAAAAACGTTCTACAAAGGGTGCACAGGTGGAGATATAAAGATGACATAGTGGGCACATGCC

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products