Psilocybe auklandiae : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regalar price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. auklandiae

An Australasian species described in 1991 by Gastón Guzmán, Chris King and Victor Bandala in 'A new species of Psilocybe of section Zapotecorum from New Zealand’. Psilocybe auklandiae is only found in the region of Aukland, NZ. Interestingly, though it is divergent genetically from P. Zapotecorum from Mexico, it is microscopically identical.

Description

• Pileus (Cap): 15-55 mm diam., broad-conic, expanding to broadly umbonate to more or less flattened, with edges becoming slightly upturned and often splitting; dry; lacking veil remnants; dark brown to yellow-brown, striate to edge, hygrophanous, drying to pale yellow-brown to straw-coloured; staining greenish-blue with damage or age; flesh white.
• Lamellae (Gills): Adnate, greyish yellow-brown with conspicuous narrow pale margin. Stipe 35-100 x 1.5-5 mm, cylindric, finely pruinose toward top, silky-fibrillose toward base, whitish; staining greenish-blue with damage; flesh brownish.
• Stipe (Stem): 35-100 x 1.5-5 mm, cylindric, finely pruinose toward top, silky-fibrillose toward base, whitish; staining greenish-blue with damage; flesh brownish. Veil cortinoid, poorly developed, disappearing as caps mature.
• Spore print: Dark purple-brown.

Microscopic Features

• Spores: (6.5-)7-9.5 x 4-5.5 x 3.5-4.5 µm, average 8.1 x 4.9 x 4.3 µm, in face view ovate, in side view elliptic-ovate; wall brown, smooth, about 0.5 µm thick, with apical pore.
• Basidia: 20-28 x 4.5-6 µm, cylindric, 4-spored, clamped.
• Pleurocystidia: 13-19 x 4.5-6 µm, scattered, similar in shape to cheilocystidia but with shorter neck, up to 4.5 µm long.
• Cheilocystidia: 15-32 x 4-8 µm, ventricose-rostrate, with long, tapering, flexuous and sometimes bifurcate neck up to 12µm long, hyaline, thin-walled.

Ecology & Distribution

• Habitat: Clay soils among forest litter beneath Leptospermum and Dacrydium, in native forests and pine plantations.
• Range: Recorded from North Island (Auckland, Bay of Plenty), New Zealand.
• Season: Autumn to early winter (March–June in NZ).

Phylogeny

• Section: Zapotecorum

ITS SEQUENCE:

TTGTCATTAAGTTGTCCATGAAAGGACGGTTAGAAGCAGTACAATCCCATTAATGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTGAGGGGAGCCGACTAAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATGATTTATAGGCACAAGGCCATACAATACATTCTGTTACATTCTTTGGGGTATATGAAAACATAGGCCTGGTGTAGCTTCTAGGAGAGCAAGCTCTCCCGTTCACTAGTCCCAAGTCTACAAAAGGTGCACAGGTGGATAGATAAAGATGACACAGCGAGCACATGCCCCCGAGAGGACCAGCTACAACTGAGTCAAGTTCATTCAATAATGATCCTTCCGCAGGTTCACCTTAC

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.