Psilocybe angulospora : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-175
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regalar price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below


Psilocybe angulospora

Frequently found growing from the soil of potted houseplants and in greenhouses in New Zealand, Psilocybe angulospora was first collected and described growing from dung in the Qingtiangang grassland in Taiwan in 2015 following reports of accidental poisoning.

Description

  • Pileus (Cap): 0.8–2 cm in diameter, light brown to yellowish white, brown at aged, eye gray to dark blue when bruised, hygrophanous, campanulate, often with an acute papilla, with striate and a slight incurve to straight margin, surface glabrous and slightly fibrous, context sturdy, grayish orange to yellowish white
  • Lamellae (Gills): Violet brown, brownish gray when younger, closely aggregate and thin, with one or three short lamellulae between two lamellae, with smooth margin, narrowly adnate.
  • Stipe (Stem): 4–6 cm Å~ 1–2 mm, orange white to birch bark gray, eye gray to dark blue when bruised, cylindrical, centric, surface smooth, glabrous and slightly fibrous, context sturdy, golden blonde to orange white, hollow at top but filled with white fibrous pith under position comparable to annulus. Annulus absent, but partial veil often leaving appressed, fragile, grayish brown to black fibrils at nearly the middle of the stipe.
  • Spore print: Purple-brown.

Microscopic Features

  • Spores: 7.6–10.2(–11.5) Å~ 5.8–8.1 Å~ 4.7– 7.1 μm, average 9.3 Å~ 6.8 Å~ 5.8 μm, Q front = 1.08– 1.64(–1.77), average Q front = 1.37, Qm front = 1.33– 1.41, average Qm front = 1.37, Q side = 1.27–1.94(–2.04), average Q side = 1.61, Qm side = 1.51–1.63(–1.81), average Qm side = 1.62 (104, 5), reddish gray, grayish orange to cinnamon brown in Meltzer’s reagent, subrhomboid at front, ellipsoidal to oval at side, smooth, thick-walled, sometimes with vacuoles, with an eccentric large germ pore that appears centric in the front view.
  • Basidia:  20.9–27.2(–32.2) Å~ 6.1–10.4 μm (19, 4), 4-spored, broadly fusiform to broadly clavate.
  • Pleurocystidia: Absent.
  • Cheilocystidia: Leptocystidia, 16.4–26.3(–29.2) μm in length, (1.6–)1.8– 3.0(–3.6) μm wide at apex, (3.6–)4.5–7.1 μm wide at base (37, 4), fusiform to lageniform, sometimes bifurcate, hyaline, clustered, abundant on gill edges.

Ecology & Distribution

  • Habitat: On heavily manured soil, scattered. Potted houseplants and in greenhouses.
  • Range: Known from Taiwan and New Zealand.
  • Season: Summer (type collected in August).

Phylogeny

  • Section: Semilanceatae


ITS SEQUENCE:

TTGAGGTCAATTGTCATTTGTATTGTCCAAAAATGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGCCCACGGCGTAGATAATTATCACACCAATAGACGGTTTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACTTCTTGACGAAGCCAGCAAAAGACCCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACGAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTCGTGAAAGCAATCCTCCCGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGG

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products