Psilocybe alutacea : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regalar price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below.

P. alutacea

Native to Australia and New Zealand, this rare species was originally described in 2006. Psilocybe alutacea belongs to section Semilanceatae.

Description

• Cap (Pileus): 10–25 mm diameter. Convex to campanulate (bell-shaped), sometimes with a slight umbo. Brownish to yellow-brown when moist, strongly hygrophanous, drying to pale straw or whitish. Smooth, viscid when moist (due to separable pellicle). Even, often translucent-striate when moist.
• Gills (Lamellae): Adnate to adnexed. Pale brown when young, becoming dark purplish-brown with maturity. Edges lighter, whitish due to cystidia.
• Stipe (Stem): 30–60 mm long × 1–2 mm thick. Slender, whitish to pale brown. Smooth to finely fibrillose; hollow and fragile. Sometimes with fine white mycelium; bruises blue when damaged. No annulus.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Ellipsoid to subrhomboid; approx. 10–12 × 6–7 µm; thick-walled with a distinct germ pore.

Ecology & Distribution

• Habitat: Coprophilous; typically grows on dung of horses, cows, and marsupials, sometimes also on rich soils in grassy areas.
• Range: Found in southeastern Australia, Tasmania, and New Zealand.
• Season: Fruits during cooler, wetter months (autumn to early winter in the Southern Hemisphere).

Phylogeny:

• Section: Semilanceatae

ITS SEQUENCE:

ATTTGAGGTCAATTGTCATTTATATTGTCCAGTGAAGGACGGTTAGAAGCAGCACAATCCCATTCATGCAGACGTCCACGGCGTAGATAATTATCACACCAATAGACGGTTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCATATGATACATTCTGTTACATACTTTGGGGTATATGAAAACGTAGGCCTGGGCTTAATTGCAAGGAGAGCTCGTGAAAGCAATCCTCCCGACCGAGTTGCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCTCGAGAGGACCAGCTGCAACCGAGCCAAGTTCATTCAATAATGATCCTTCCGCA

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.