Panaeolopsis sp. : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid. 

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories. 

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Panaeolopsis sp.

This fascinating and unique secotioid species may not be a species at all. Once a genus of its own, all species once classified under Panaeolopsis have been moved to Panaeolus as indicated by molecular analysis. DNA sequencing also indicates that many, if not all formerly Panaeolopsis are simply secotioid versions of existing Panaeolus species. This particular collection shows a very close affinity for P. cinctulus and may be a secotioid version of that taxon. This isolate produces rings of bright blue sclerotia on agar, just as P. cinctulus does, which can grow quite large.

Description

• Pileus (Cap): 10-15 X 20mm, fusiform-ellipsoid with margin firmly adpressed to stipe and forming distinct sterile flap (2mm broad) around stipe, not expanding or expanding slowly and only slightly, pallid fawn except for darker marginal band; margin lacking velar remnants.
• Stipe (Stem): 30-50 x 2-3mm, cylindric, whitish or pale brown (fulvous), pruinose but soon becoming smooth, dry, solid.
• Lamellae (Gills): crowded, ascending, greyish black with distinctly paler margin.
• Spore Print: Black.

Microscopic Features

• Spores: 12-14x8.5-9.5x7-7.5μm, lenticular-mitriform, elliptic in side-view, truncate because of large, distinct very slightly excentric germ-pore, smooth, black tinted bronze s.m., not discolouring in conc, sulphuric acid.
• Basidia: 2- or 4-spored, 22-25x11-12μm, with prominent sterigmata.
• Pleurocystidia: Absent.
• Cheilocystidia: In a broad strongly adhering band, 24.5-36.5x5-6.5μm, ampullaceous to fusiform with cylindric (4.5-5.5μm) neck and obtuse apex, hyaline, thin-walled, frequently very strongly pedicellate.

Ecology & Distribution

• Habitat: Well-fertilized lawns, gardens, compost piles, horse dung/rotting hay, manure-enriched soil.
• Range: Widely distributed globally.
• Season: Spring through fall in many temperate areas.

ITS SEQUENCE:

CCCTCTTGGGGGAATTGTGCACACCTTACCTTTTTTGTTTTTCCACCTGTGCACACACTGTAGGTCTGAAGGAGGGGAAGGGGGGGGAAGTAACACTCTCCCCCTGAAACACTTTCAGGTCCTATGTATTTTACACATACACTATTAAAAGTAACAGAACGATTCAATGGGCTTCCAAGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCAATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCAACACTTTTGTGATTGATGGCTTGGATGTGGAGGTTTTTCTGCAGGCTGTTAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTATTGGTGTGATAATTATCTACGCCGTGGATTATAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACCGTCCCCTTTGTTGGAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.