P. cf. antioquiensis (P. angkoria sp. nov.) : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. cf. antioquiensis (P. angkoria sp. nov.)

Initially proposed as the new species Psilocybe angkoria sp. nov. (Sihanonth and Allen) in 2003. it was later “identified” as Psilocybe antioquiensis by Dr. Gaston Guzman. P. antioquiensis was formerly reported from Mexico and South America and the identification of the Cambodian material is now suspect. The holotype from Columbia has yet to be genetically sequenced, but based on published microscopy, it is likely a synonym of P. mexicana (Section Mexicanae). The material offered here was sequenced and is the equivalent of sample “Allen C” in Section Zapotecorum. Without the holotype sequence for a direct comparison for species confirmation, we will label this sample as Psilocybe cf. antioquiensis. It is likely an undescribed species and may go back to its originally proposed name of P. angkoria which we don’t think was ever actually published.

Although laboratory specimens resemble P. mexicana, this species has not been observed to form sclerotia.

Description

• Pileus (Cap): 10–25 mm diameter. Convex to campanulate, sometimes with slight umbo. Brownish to reddish-brown when moist, hygrophanous, fading to yellow-brown or straw-colored when dry. Smooth, moist to slightly viscid when fresh. Translucent-striate when moist.
• Lamellae (Gills): Adnate to adnexed. Light brown when young, darkening to purple-brown at maturity. Edges often lighter (whitish).
• Stipe (Stem): 30–70 mm long × 1–2 mm thick.Slender, whitish to pale brown. Smooth to slightly fibrillose; hollow and fragile. May show white mycelium or rhizomorphic strands. Bluing reaction when bruised. No annulus present.
• Spore Print: Dark purplish-brown.

Microscopic Features:

• Spores: Subellipsoid to sublentiform, 8.0 – 9.5 x 5.0 – 6.0 µm, with a distinct germ pore.
• Basidia: 4-spored.
• Pleurocystidia: Absent or very rare.
• Cheilocystidia: Utriform to broadly lageniform with a capitate (rounded) apex, 20 – 30 µm long. This is a key identifier.

Ecology & Distribution

• Habitat: Saprotrophic; grows on soil rich in organic matter in subtropical forests.
• Range: P. antioquiensis was described from Antioquia, Colombia, and likely distributed in other montane regions of the northern Andes. This collection was made in Siem Reap, Cambodia, by John Allen in August 2003.
• Season: Fruits during the wet season.

Phylogeny

• Section: Zapotecorum

ITS SEQUENCE:

TTCCGTAGGTGACTCGCGGAACGATCATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACTCCAGGCCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTACTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATGTACTGCTTCTAACGTCCTTCATGGACACTTAATGACAATTGACTCAATCAGTA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.