Psilocybe antioquensis : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-160
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below.

P. antioquensis

A psychoactive mushroom containing psilocybin, Psilocybe antioquensis was first described in 1994 from Antioquia, Colombia, hence the name.

Description

  • Cap (Pileus): 10–25 mm diameter. Convex to campanulate, sometimes with slight umbo. Brownish to reddish-brown when moist, hygrophanous, fading to yellow-brown or straw-colored when dry. Smooth, moist to slightly viscid when fresh. Translucent-striate when moist.
  • Gills (Lamellae): Adnate to adnexed. Light brown when young, darkening to purple-brown at maturity. Edges often lighter (whitish).
  • Stipe (Stem): 30–70 mm long × 1–2 mm thick.Slender, whitish to pale brown. Smooth to slightly fibrillose; hollow and fragile. May show white mycelium or rhizomorphic strands. Bluing reaction when bruised. No annulus present.
  • Spore Print: Dark purplish-brown.
  • Spores (Microscopic): Subrhomboid to ellipsoid; approx. 7–9 × 4.5–6 µm; thick-walled with a germ pore.

Ecology & Distribution

  • Habitat: Saprotrophic; grows on soil rich in organic matter in subtropical forests.
  • Range: Described from Antioquia, Colombia, and likely distributed in other montane regions of the northern Andes.
  • Season: Fruits during the wet season.

Phylogeny

  • Section: Zapotecorum

ITS SEQUENCE:

TTCCGTAGGTGACTCGCGGAACGATCATTATTGAATGAACTTGACTCAGTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACTCCAGGCCTATGTTTTCATATACCCCAAAGAATGTAATAGAATGTACTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATGTACTGCTTCTAACGTCCTTCATGGACACTTAATGACAATTGACTCAATCAGTA

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

How to remove solution from sporeworks.com MycoTrue(TM) isolate vial.

To properly remove the stored isolate solution from your sporeworks.com MycoTrue(TM) vial, you will need a sterile syringe, filled with sterile air. We supply a syringe, filter, and needle for this purpose with your order, and demonstrate the proper procedure in this video.

Related Products