Gymnopilus luteofolius : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid. 

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories. 

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Gymnopilus luteofolius

Gymnopilus luteofolius is well-known, but unraveling its taxonomy has been complex. It is part of a group of similar, brightly colored, bitter-tasting Gymnopilus species. The striking colors and texture of this species makes it one of the most visually arresting and beautiful psychoactive mushrooms.

Description

• Pileus (Cap): ~2 cm up to 10–11 cm in diameter in large specimens. Convex when young, becoming broadly convex to nearly plane with age; margin initially incurved, later more straight or slightly uplifted. Surface dry, with scales (squamulose) or fibrillose texture, especially toward disc; color may be vinaceous-purple, reddish-brown, or brick red in youth, fading to brownish or yellow tones with age. Cap cuticle may also show greenish stains or bruising in some specimens.
• Lamellae (Gills): Adnate or notched (sometimes adnexed or with a slight decurrent tooth), Close; often with many lamellulae (short gills). Start pale yellow, becoming deep yellow or ochraceous, then rusty-orange / orange-brown as spores mature.
• Stipe (Stem): ~3–9 cm (or in some sources up to 10 cm), thickness ~0.3–1.5 cm (5–15 mm) or more depending on specimen. Generally more or less equal, sometimes slightly swollen at base. Surface is fibrillose, with similar coloration to cap; may be covered with rusty spore deposits; sometimes shows greenish or bluish discoloration near base in some collections.
• Spore Print: Rusty-orange or orange-brown.

Microscopic Features

• Spores: Ellipsoid to subellipsoid, roughened (verrucose), dextrinoid (i.e. stain in Melzer’s reagent). Size ranges in literature ~5.5–8.5 × 3.5–5 µm (some sources more narrow).
• Basidia: Four-spored.
• Pleurocystidia: Absent or very rare/inconspicuous.
• Cheilocystidia: Often present and abundant, described variously as fusiform, lageniform, or capitate.

Ecology & Distribution

• Habitat: In clusters or loose groups on decaying wood, wood chips, logs, stumps—both hardwood and conifer substrates.
• Range: Found in North America (widely).
• Season: Summer through fall (or even into winter in warm climates) depending on region.

ITS SEQUENCE:

GTGGTTGAGCTGACTCTTTTGGGAGTATGTGCTCGCTCGTCATCTTTATCTTTCCACCTGTGCACTTTTTGTAGATTTGGATGTAACTGTCCGAGGCAACTCGGTTGGGAGGAATGCTATCTTTGATGGCTTTCCTTGTATGTCCAAGTCTATGTCTTCATATACTCCAAGTATGTAACAGAATGTATCACTGGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACTAGCTTTTGCGAAGTAATGGCTTGGACTTGGGGGTCTTTTGCTGGTTTCGAAAGAGATCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGTGGACTGTCTATTGGTGTGATAATTATCTACGCCGTTAGATGTCTGCTATTAAATGGGATGTGCTGCTTCTAATCGTCCTCAGGACAATTATTGACCATTTGACCTCAAATCA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.