Psilocybe baeocystis : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. baeocystis:

First described scientifically in 1945 by Singer & A.H. Smith, Psilocybe baeocystis is typically found in the Pacific Northwest of North America, often fruiting in wood chips, bark mulch, lawns, or rich soils, particularly in urban and suburban environments.

Description

• Cap: 1.5–5.5 cm in diameter; broadly conic to convex when young, expanding with age. Surface is hygrophanous, dark olive-brown to caramel when moist, fading to pale tan or buff as it dries. The cap often has a gelatinous pellicle that can be peeled away.
• Gills: Attached, close, and becoming adnate to sinuate; color transitions from light brown to dark purplish-brown as spores mature.
• Stipe (Stem): 5–7.5 cm long and 2–4 mm thick; slender, fragile, whitish to brownish, often with blue-green bruising where handled. Sometimes slightly swollen at the base.
• Spore Print: Dark purplish-brown to blackish-violet.
• Spores (microscopic): Ellipsoid, thick-walled, with a distinct germ pore; typically 9–13 × 5–7 μm.

Ecology & Distribution

• Habitat: Grows scattered to gregarious, often in wood chips, bark mulch, compost piles, rich soil, and occasionally on lawns. Strongly associated with human-modified environments.
• Range: Commonly reported from the Pacific Northwest of North America (particularly Oregon and Washington), fruiting in cool, wet conditions. Also reported from Maine and Connecticut.
• Season: Typically from late summer through early winter after rains.

Phylogeny

• Section: Semilanceatae

ITS SEQUENCE:

GCTCGGTTGCAGCTGGTCCTCTCGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCTGTGCACCTTTTGTAGACCTGGATTAGTTAACTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGCAATTAACCCAGGCCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTATATTGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTTCGTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.