Psilocybe caerulipes : MycoTrue(TM) Isolate Vial

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Psilocybe caerulipes

Originally described in 1881 by C.H. Peck as Agaricus caerulipes, and known colloquially as the “blue foot” mushroom, Psilocybe caerulipes is a somewhat rare but widespread species can be found throughout the Appalachian range on well-rotted birch, maple and beech logs and branches. It is probably more common than it seems, but its small stature can make it hard to see among the leaf litter of a forest floor.

Description

• Pileus (Cap): 1-4 cm, obtusely conic to convex, margin is initially turned inwards, later becoming broadly convex to flattened or somewhat umbilicate with a slight umbo, and at times irregular. Viscid when moist from a gelatinous pellicle, becoming dry and shiny, translucent-striate, and decorated with fine fibrillose veil remnants, often with greenish stains near the margin or a greenish tinge overall. Cinnamon brown to caramel brown when fresh, hygrophanous, fading to dingy ochraceous buff.
• Lamellae (Gills): Close but not crowded, narrow with adnate to sinuate to uncinate attachment. Nearly white at first, becoming dark brown as the spores mature; the edges are whitish and slightly fimbriate.
• Stipe (Stem): 3–6 cm long, 1.5–3 mm thick, equal to enlarging downwards, tough(ropey), and is whitish to brown at first, then pallid to bluish, becoming dingy brown towards the base with age; bruises blue; lacking annulus. Blueing often apparent at base.• Spore print: Dark brown.

Microscopic Features

• Spores: 7-10 x 4-5 μm; ellipsoid; thick-walled, and with a broad germ pore. Spores from 2-spored basidia are slightly larger.
• Basidia: 2- and 4-spored.
• Pleurocystidia: Absent.
• Cheilocystidia: 18-35 x 4.5-7.5 μm, langeniform, with a thin neck, sometimes forked, 1–2.5 μm broad at apices.

Ecology & Distribution

• Habitat: Well-rotted hardwood debris, especially beech, birch, or maple logs, in moist, rich deciduous forests.
• Range: Eastern North America: New York, Michigan, Ohio, Pennsylvania, the Appalachian region, into southeastern Canada. Disjunct populations have been collected in the cloud forests of Hidalgo and Veracruz states in Mexico.
• Season: Summer to late autumn.

Phylogeny

• Section: Semilanceatae

ITS SEQUENCE:

TGATTTGAGGTCAATTGTCATTTGTGTTGTCCATAACGGACGATTAGAAGCAGCACAATCCCATTGATGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATGCATTTAAGGGGAGCCGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATGATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCATATGATACATTCTGTTACATTCGTTGGGG

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

1. Remove syringe and syringe filter from packaging.
2. Attach syringe filter to syringe.
3. Draw plunger to fill syringe with air.
4. Remove syringe filter from syringe.
5. Attach needle to syringe.
6. Shake vial vigorously.
7. Remove cap from vial.
8. Insert needle through top of vial, into air space above the solution.
9. Inject an amount of air equal to the amount of solution you wish to draw.
10. Invert vial and release pressure on plunger to draw out solution
11. Turn upright and remove syringe from the vial.
12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.