Psilocybe semilanceatae : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

P. semilanceatae

One of the most widespread psilocybin-containing mushrooms, especially across temperate regions of Europe, North America, and parts of the Southern Hemisphere. It is the type species of section Semilanceatae, characterized by small, slender mushrooms with conical, strongly hygrophanous caps and purple-brown spore prints.

Description

• Cap (Pileus): 5–25 mm diameter. Distinctly conic to bell-shaped, often with a sharp umbo (“nipple”) at the center. Smooth, viscid when moist due to a thin gelatinous pellicle (separable). Olive-brown to yellow-brown when moist, strongly hygrophanous, drying to a pale straw or whitish tone. Translucent-striate when moist.
• Gills (Lamellae): Adnexed to adnate. Initially pale cream, becoming dark purple-brown with spore maturity. Edges often whitish from sterile cells (cheilocystidia).
• Stipe (Stem): 40–100 mm long × 1–3 mm thick. Slender, flexible, and fibrous. Whitish to pale brownish, often darker toward the base. Smooth, sometimes slightly striate; lacks an annulus. Base often slightly swollen, with attached white mycelium.
• Spore Print: Dark purplish-brown.
• Spores (Microscopic): Ellipsoid to subrhomboid; 11–14 × 7–9 µm; thick-walled with a distinct germ pore.

Ecology & Distribution

• Habitat: Not dung-loving itself but grows in grassy meadows and pastures, especially where soil is enriched by livestock manure. It does not grow directly on dung but is closely associated with grassland ecosystems.
• Range: Widespread across Europe, North America, South America, New Zealand, and Australia (introduced).
• Season: Fruiting mainly in autumn, after periods of rain and cooler temperatures.

Phylogeny

• Section: Semilanceata (type species)

ITS SEQUENCE:

ATTTGAGGTCAATTGTCATTTGTATTGTCCAGTGAAGGACGGTTAGAAGCAGCGCAATCCCATTCATGCAAAGGTCCACGGCGTAGATAATTATCACACCAATAGACGGCTCTGCGCGGGGCACCGGCTAATACATTTAAGGGGAGCAGACCTCTTGACGAAGCCAGCAAAAGACCCCCACATCCAAGCCATTATCAGCAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCACAAGGCCAATATAATACATTCTGTTACATTCTTTGGGGTATATGAAAACGTAGGCCTGGGTTAATTGCAAGGAGAGCTTGTGAAAGCAATCCTCTTGACCGAGTTTCCTCGGAAAGTTAACTAATCCAGGTCTACAAAAGGTGCACAGGTGGAGAGATAAAGATGACACGGCGAGCACATGCCCCCGAGAGGACCAGCTACAACCGAGCCAAGTTCATTCAATAATGATC

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.