Psilocybe gandalfiana : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-320
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid.

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories.

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

P. gandalfiana

A rare secotioid Psilocybe discovered in the Shasta/Trinity National Forest, in the mountains of California, in 2023 with a shape resembling a wizard’s hat.

Description

  • Pileus (Cap): Smooth, viscid when moist. Color is a distinctive greyish-blue to silvery-blue, often with olive tones, maturing to a pale yellowish-brown. Exhibits a strong bluing reaction when bruised. Ovoid to distinctly mitriform, mitre- or wizard's hat-shaped, hence the name.
  • Lamellae (Gills):The gleba (internal spore-bearing tissue) is loculate (chambered) rather than having strongly convoluted lamellae. The columella is present but often less developed than in P. weraroa. Spore disbursal by insects and mollusks.
  • Stipe (Stem): Up to 40 mm long and 6 mm wide, fibrous, typically white to French-gray with occasional yellow-brown base.
  • Internal Structure: The gleba (internal spore-bearing tissue) is loculate (chambered) rather than having strongly convoluted lamellae. The columella is present but often less developed than in P. weraroa.
  • Spore print: Chocolate brown.

Microscopic Features

This species is, as of yet, not formally described. Microscopic features will be updated when more specific info is available.

  • Spores: Ellipsoid, inequilateral, with dimensions in the range of 11–14 x 6.5–8.0 µm, with a distinct germ pore.
  • Basidia: Four-spored. Clavate.
  • Pleurocystidia: Present on gleba (spore-bearing surface), lageniform (flask-shaped) to utriform (urn-shaped).
  • Cheilocystidia: Present on gleba (edges of glebal chambers), lageniform (flask-shaped) to utriform (urn-shaped).

Ecology & Distribution

  • Habitat: Observed in high-elevation meadows and marshy mountain bogs, often appearing during summer months near snowmelt. It is a wood-decaying species, fruiting from soil with organic matter such as wood chips or decomposing wood debris.
  • Range: Reported near Mt. Shasta in California, in the Shasta-Trinity National Forest, and in the Stanislaus National Forest.
  • Season: Summer.

Phylogeny

  • Section: Cordisporae.
  • Related Species: Though closely resembling the P. polytrichoides it shares habitat with, it is only distantly related to that species, being closest genetically to P. hopii.


ITS SEQUENCE:

CTGGCCCTCTCGGGGGCATGTGCTCGCCTGTCATCTTTATATCTCCACCTGTGAACCTTTTGTAGACGTTTGAAAGAAGACTGGATAGGATGGGGGAAAGCTTCACGGCCATCCCAAAGTTGAAGGTCTTTTTCTCAAGCGGTCTACGTTTTCATATACCCCAAGGAATGTAACAGAATGTATCATATGGCCTTGTGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTCTTTTGCCGGCTTCATCTGAAGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTATCAATGGGTTTTAAAAGCTGCTTCTAACCGTCCGTTCATTCGGACAGCATATAATGACAATTTGACCTCAAATCAGGT

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products