Conocybula smithii : MycoTrue(TM) Isolate Vial

Tags
Market Price: $55.00
SAVE 29%
Our Price

$39.00

Weight 0.10 lbs
SKU MycTru-060
Quantity
Description

Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price!

MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid. 

Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories. 

Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below

Conocybula smithii

A rare, psilocybin-containing mushroom first described in 1967 by Roy Watling as Conocybe smithii. It is named in honor of the American mycologist Alexander H. Smith, who contributed extensively to agaric taxonomy. The species was recently (2024) updated to Conocybula smithii. It is one of the few members of Conocybula reported to contain psilocybin and psilocin, making it psychoactive, although it is not commonly encountered.

Description

  • Cap (Pileus): Small, 5–15 mm diameter. Conic to campanulate (bell-shaped), sometimes becoming convex with age. Yellow-brown to cinnamon-brown, hygrophanous, often darker at the center. Smooth, sometimes with a slight sheen; margin even, occasionally faintly striate when moist.
  • Gills (Lamellae): Adnate to adnexed. Pale brown when young, becoming cinnamon to rusty brown with maturity due to spore deposition. Moderately close spacing.
  • Stipe (Stem): Slender, 25–60 mm long × 1–2 mm thick. Whitish to pale yellowish, sometimes darker toward the base. Fragile, hollow, pruinose (powdery) toward the apex. Lacks an annulus (ring).

Microscopic Features

  • Spores: Smooth and ellipsoid, thick walled, small but distinct germ-pore. Size (6.5)7.0 - 9.0 x 4.0 - 4.5(5) µm.
  • Basidia: 4-spored, clavate.
  • Pleurocystidia: Absent.
  • Cheilocystidia: Lecythiform, (flask-shaped with a small, rounded head). This is a key identifier for the species.

Ecology & Distribution

  • Habitat: Saprotrophic; grows in rich soil, dung, or well-decayed organic debris.
  • Range: Described from the United States, but may occur sporadically in temperate regions of North America and possibly Europe.
  • Season: Fruits in summer to autumn, especially after rains.

Phylogeny

  • Section: Cyanopodae

ITS SEQUENCE:

TTGAGGTCAAATGATCATTAAGTTGTTGGCAGGGCCAACGGTTAGAAGCAGAGTCCCACTCAAAGGCTGTCGTCTGCATAGCGTAGATAATTATCACACTAACAGATGGACTGCAGGGGTTACACTCCAGCTAATGTATTTGAGGAGAGCAGACCGTGAGGCCCGCAAAGACTCCCAATTCCAAGCCGCTCTCTACACAAAAATGTAAGAGTGGTTGATAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAGATTTTATAGGCTGTTTTAAGGCCTTCTAAACGTTCTGATACATTCTTTTGGGGTATATTGTAATAACGTAGACCCTCTGGACGTTGCTCACAGGAAAGCCGACAGCAGTGAAGCTGCGCAGCAAACCTCAACTCCGAGCCCAAAAGCTCGATAACCAGAATACGGGTCTACAGAGGGTGCACAGGTGGAAAAGTAAAAATGACAGACGTGCACAGTACTCCCTGAGGAGCCAGCAACAGTCCACCAAGTTTATTCATTAATGATCCTTCCGCA

HOW TO UTILIZE MYCOTRUE VIALS - (see video below)

  1. Remove syringe and syringe filter from packaging.
  2. Attach syringe filter to syringe.
  3. Draw plunger to fill syringe with air.
  4. Remove syringe filter from syringe.
  5. Attach needle to syringe.
  6. Shake vial vigorously.
  7. Remove cap from vial.
  8. Insert needle through top of vial, into air space above the solution.
  9. Inject an amount of air equal to the amount of solution you wish to draw.
  10. Invert vial and release pressure on plunger to draw out solution
  11. Turn upright and remove syringe from the vial.
  12. Cap syringe.

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.

Related Products