Conocybe smithii : MycoTrue(TM) Isolate Vial

MycoTrue(TM) - Genetically verified material as isolate in aqueous solution provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6mo past purchase date.

Conocybe smithii

A rare, psilocybin-containing mushroom first described in 1967 by Roy Watling. It is named in honor of the American mycologist Alexander H. Smith, who contributed extensively to agaric taxonomy. It is one of the few members of Conocybe reported to contain psilocybin and psilocin, making it psychoactive, although it is not commonly encountered.

Description

• Cap (Pileus): Small, 5–15 mm diameter. Conic to campanulate (bell-shaped), sometimes becoming convex with age. Yellow-brown to cinnamon-brown, hygrophanous, often darker at the center. Smooth, sometimes with a slight sheen; margin even, occasionally faintly striate when moist.
• Gills (Lamellae): Adnate to adnexed. Pale brown when young, becoming cinnamon to rusty brown with maturity due to spore deposition. Moderately close spacing.
• Stipe (Stem): Slender, 25–60 mm long × 1–2 mm thick. Whitish to pale yellowish, sometimes darker toward the base. Fragile, hollow, pruinose (powdery) toward the apex. Lacks an annulus (ring).
• Spore Print: Rusty to cinnamon brown (typical of Conocybe).

Spores (Microscopic): Ellipsoid, smooth, thick-walled, with a distinct germ pore; approx. 12–15 × 7–9 µm.

Ecology & Distribution

• Habitat: Saprotrophic; grows in rich soil, dung, or well-decayed organic debris.
• Range: Described from the United States, but may occur sporadically in temperate regions of North America and possibly Europe.
• Season: Fruits in summer to autumn, especially after rains.

ITS SEQUENCE:

TTGAGGTCAAATGATCATTAAGTTGTTGGCAGGGCCAACGGTTAGAAGCAGAGTCCCACTCAAAGGCTGTCGTCTGCATAGCGTAGATAATTATCACACTAACAGATGGACTGCAGGGGTTACACTCCAGCTAATGTATTTGAGGAGAGCAGACCGTGAGGCCCGCAAAGACTCCCAATTCCAAGCCGCTCTCTACACAAAAATGTAAGAGTGGTTGATAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAGATTTTATAGGCTGTTTTAAGGCCTTCTAAACGTTCTGATACATTCTTTTGGGGTATATTGTAATAACGTAGACCCTCTGGACGTTGCTCACAGGAAAGCCGACAGCAGTGAAGCTGCGCAGCAAACCTCAACTCCGAGCCCAAAAGCTCGATAACCAGAATACGGGTCTACAGAGGGTGCACAGGTGGAAAAGTAAAAATGACAGACGTGCACAGTACTCCCTGAGGAGCCAGCAACAGTCCACCAAGTTTATTCATTAATGATCCTTCCGCA

* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations.

California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.