Psilocybe zinnii : Spore Isolate Syringe
Description
|
Isolate (ISO) provided in sterile aqueous solution using 10cc Luer-Lok syringes. One 1.5in 16ga needle will be provided for each syringe. For more information on Spore Isolate Syringes, see our Blog Update: "Spore Isolates: What and Why." Psilocybe zinnii (Psilocybe natalensis × Psilocybe pseudoaztecorum) Comments: Psilocybe × zinnii nom. prov. is an interspecies hybrid of Psilocybe pseudoaztecorum from tropical India and Psilocybe natalensis from South Africa. Out of the many crosses we developed in the lab, this particular (F1) isolate displays significant hybrid vigor. The spores of Psilocybe × zinnii are viable and create fertile offspring, it can sustain its own population, and is genetically and phenotypically distinct from each of its parents, allowing it the distinction of species. The DNA of this strain was extracted, put through a PCR and the ITS region amplified for testing. DNA confirmed the unique genetic profile. We were surprised when we ran the sequence through NCBI BLAST to find another sequence from the same hybrid of species, provided in August of 2025 by Julian Mattucci of Imperial Scientific. A difference of two nucleotides separated our hybrid from the sample already uploaded to the databank. For the sake of convenience, we have designated it Psilocybe zinnii, named after the daughter of one of our technicians. Should the conversation lead to an official recognition of the species, more traditional naming conventions will be applied. The material offered here is isolated from F1 culture and retains the desired traits and hybrid vigor. For more information on the development of this variety, please check out our blog on The Hybridizatoin of Psilocybe Species - Psilocybe zinnii. More to come. Strain Origin: Interspecific hybrid of Psilocybe natalensis × Psilocybe pseudoaztecorum Description
Microscopic Features
Ecology & Distribution
Phylogeny
ITS SEQUENCE:
ATTTGAGGTCAATTGTCATTAATTGTCTGACTGAACAGACGGTTAGAAGCAGCTTCAACCCATTATAGCAGACATCCACGGCGTAGATAATTATCACACCAATAGACGGTCCACAGCGGGCAGCCGGCTAATGCATTTAAGGGGAGCTGACTTCGTAAGAAGCCGGCAAAAGAACCCCCAAGTCCAAGCCATTACACAAGCTAACAAAAGCTGGTAAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATTGTTTTATAGGCACAAGGCCATATAGATACATTCTGGTAC
Psilocybe genera spores, provided on sterile swabs. Spores are supplied on a nylon tipped 6.5in sterile swab stick in a plastic collection tube. Each spore swab will include instructions on how to properly view your spores under a microscope. * Spores intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations. California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions.
|

Psilocybe zinnii

Psilocybe x zinnii nom. prov. (Psilocybe natalensis x Psilocybe pseudoaztecorum)

Psilocybe zinnii

Psilocybe zinnii

Psilocybe zinnii

Psilocybe zinnii (Psilocybe natalensis x Psilocybe pseudoaztecorum)

Psilocybe zinnii

Psilocybe x zinnii nom. prov. family tree












