Conocybula smithii : MycoTrue(TM) Isolate Vial
Description
|
Introductory Pricing! - For a limited time, enjoy examining the exciting new MycoTrue(TM) Isolate Vials for only $39 each! That's almost 30% off regular price! MycoTrue(TM) - DNA verified research material as liquid isolate in aqueous solution. Provided in 10ml glass serum vial with injectable lid. Store refrigerated, guaranteed 6 months after receipt of order. Designed for accredited laboratories. Each order provided with one sterility packaged syringe filter, syringe, and needle. See instructions and video below Conocybula smithii A rare, psilocybin-containing mushroom first described in 1967 by Roy Watling as Conocybe smithii. It is named in honor of the American mycologist Alexander H. Smith, who contributed extensively to agaric taxonomy. The species was recently (2024) updated to Conocybula smithii. It is one of the few members of Conocybula reported to contain psilocybin and psilocin, making it psychoactive, although it is not commonly encountered. Description
Microscopic Features
Ecology & Distribution
Phylogeny
ITS SEQUENCE:
TTGAGGTCAAATGATCATTAAGTTGTTGGCAGGGCCAACGGTTAGAAGCAGAGTCCCACTCAAAGGCTGTCGTCTGCATAGCGTAGATAATTATCACACTAACAGATGGACTGCAGGGGTTACACTCCAGCTAATGTATTTGAGGAGAGCAGACCGTGAGGCCCGCAAAGACTCCCAATTCCAAGCCGCTCTCTACACAAAAATGTAAGAGTGGTTGATAATTTAATGACACTCAAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATAGATTTTATAGGCTGTTTTAAGGCCTTCTAAACGTTCTGATACATTCTTTTGGGGTATATTGTAATAACGTAGACCCTCTGGACGTTGCTCACAGGAAAGCCGACAGCAGTGAAGCTGCGCAGCAAACCTCAACTCCGAGCCCAAAAGCTCGATAACCAGAATACGGGTCTACAGAGGGTGCACAGGTGGAAAAGTAAAAATGACAGACGTGCACAGTACTCCCTGAGGAGCCAGCAACAGTCCACCAAGTTTATTCATTAATGATCCTTCCGCA HOW TO UTILIZE MYCOTRUE VIALS - (see video below)
* MycoTrue(TM) intended for microscopy and taxonomy purposes only. Images provided for informational and educational reference only and originate from cultivators and labs outside the US. Cultivation of this species is illegal in many countries including the United States. Please check your local regulations. California, Idaho, Florida, and Georgia residents: Orders requesting Psilocybe Genera Spores shipped to California, Idaho, Florida, and Georgia will be refused, voided, or refunded. Possession of these mushroom spores may be illegal in CA, ID, FL, and GA without the proper permissions. |

Conocybe smithii : MycoTrue(TM) Isolate Vial

Conocybe smithii : MycoTrue(TM) Isolate Vial










