Perhaps the most dramatic change has been the shift toward offering isolates alongside traditional spore syringes and prints. Out of an abundance of caution, we delayed offering isolates pending further evaluations allowing us to be certain providing this product would enhance our customer’s mycological microscopy journey.

After extensive product testing and research we are now confidently adding spore isolate syringes to our catalog, expanding the products we offer to our customers without any increased risk. These spore isolate syringes represent the very best access to thoroughly tested genetic material for microscopy, providing shorter observation times with increased stability.

Our evaluations have included laboratory testing of all of our products as well as the acquisition of Certificates of Analysis demonstrating the legality of our spore isolate syringes. We do believe the research opportunities are limitless with this new, expanding catalog, and we are excited to be able to provide new options to those engaged with microscopic study.

Every one of the strains we offer, every variety and species, is developed for Sporeworks at our state-of-the-art labs in Austria and Oregon. The Mazatec isolate we provide is not the Mazatec isolate provided by another vendor. The Golden Teacher isolate you get from us is not the Golden Teacher you’ll receive from another vendor. Each and every strain is unique to us and will be evaluated regularly and re-isolated as needed, ensuring only the best genetics leave our facility to be studied.

Over the next year, we hope to dramatically expand the selection of exotic species in our catalog, each paired with DNA analysis verifying the species’ identity, with the ultimate aim of a comprehensive library of psilocybin-genera species for access to researchers. We will also be expanding our catalog of P. cubensis varieties in both isolate and spore form, hoping to have on offer as much geographic and genetic diversity as possible.

We are very excited about this new frontier in microscopy research, and look forward to all the changes to come. Check back often, as things will move quickly, and if you have any questions, feel free to send us an email, or drop a line to our dedicated customer service department.

So, what exactly is an Isolate? In contrast to the multi-spore syringes, which contain a wide variety of genetic material in tens of thousands of spores, our isolates contain only one set of genes. This assures that it will perform consistently and uniformly in your research. In instances where genetic diversity is desired, we recommend our multi spore products. When predictability is preferred, isolates are the best choice.

Happy Mushrooming!

-Sporeworks

Florida HB 651 Section 51. Section 500.75 reads as follows:

1. Section 51. Section 500.75, Florida Statutes, is created to read: 500.75 Mushroom spores and mycelium; offenses.—It is unlawful to transport or offer to transport, import into this state, sell or offer for sale, furnish, or give away spores or mycelium capable of producing mushrooms or other material which will contain a controlled substance, including psilocybin or psilocyn, during its lifecycle. A person who violates this section commits a misdemeanor of the first degree, punishable as provided in s. 775.082 or s. 775.083.

This measure represents one of the first restrictive laws regarding psilocybin spores since banning in Idaho nearly two decades ago. The internet does not provide much detail or reporting on this recent measure, so it is our intent to raise awareness for Florida based mycologists who may be concerned about future access to this material.

The few bits of reportage on the subject include a story from Marijuana Moment: Florida Lawmakers Approve Bills To Outlaw Psychedelic Mushroom Spores and a CannaCore Group Blog Post "Florida Moves Forward to Ban Psychedelic Mushroom Spores." We will update this blog posting with more news links as they become available.

For those seeking information on contacting Florida State House and Senate officials, there is a fantastic post in r/shrooms - Florida Residents: Take action againsgt the criminalization of spores (I'll outline how). This thread contains good suggestions and links for reaching responsible parties, or those voting on this measure.

While we're hopeful the course of HB 651 can be altered, we must also prepare to adjust our policies accordingly to remain in compliance with state laws. Should this measure pass as planned, Sporeworks would no longer be able to ship any of our psilocybin genera spore product to residents in the state of Florida after July 1. 

Due to shipping pick-up schedules and post-dating of packages, the last day we will be able to process and ship orders to the state of Florida will be Thursday June 26th.

Recently, the P. natalensis holotype has been sequenced and found to be different than our material. We knew it wasn’t cubensis and now we knew it wasn’t natalensis. While we waited for a publication to officially name the new species, we temporarily changed our material to Psilocybe aff. natalensis to show that what we had was related to P. natalensis, but different enough to merit its own species designation. And now the wait is essentially over with this preprint of this study “Discovery of the closest free-living relative of the domesticated “magic mushroom” Psilocybe cubensis in Africa” provisionally naming the new species as P. ochraceocentrata. This is a preprint so the name isn’t “official” but we expect it will be a valid species name in the near future.

Many psilocybe spore collectors are now scrambling for “real” Psilocybe natalensis, but it should be understood that all of the current positive reports for P. natalensis (and P. aff. natalensis ) are actually of Psilocybe ochraceocentrata. Currently (2024), there are no readily available sources of Psilocybe natalensis and it is expected that many vendors may not update their “P. natalensis” descriptions to reflect the name change in a timely manner. Eventually confirmed authentic P. natalensis will be available to the community, but for now, buyer beware.

The cultivation aspects of authentic P. natalensis are mostly unknown at this time but we can make some educated guesses on how it will compare to the very popular P. ochraceocentrata based on a few early cultivations of real P. natalensis and the closely related species such as P. chuziongensis and P. psuedoaztecorum.

The image below is the most complete phylogeny I could find on the species of interest. I edited this screen grab to update the new species name to avoid confusion. I found this image on the Myc Check Podcast with Yoshi Amano which is well worth watching for the cultivation results of P. natalensis. I highly recommend. As you can see from the phylogeny, P. ochraceocentrata is very closely related to P. cubensis. It is, in fact, the closest known relative to P. cubensis, which explains its ability to hybridize with P. cubensis. Hybridization between P. cubensis and the more distantly related P. natalensisis less likely.

Unfortunately, it appears that P. natalensis will not be as easy to cultivate as P. ochraceocentrata. Cultivation attempts seen on the Shroomery in 2014 with the closely related species P. psuedoaztecorum from India produced mushrooms slowly and with difficulty, with characteristic top heavy, spindle shaped mushrooms.

The recent cultivation with genetically confirmed Psilocybe natalensis, as seen in the Myc Check Podcast, shows similar spindle shaped mushrooms, which supports the close relationship to P. psuedoaztecorum.

We are going to guess that the difficulty, slow growth and low yield will prevent widespread cultivation by all but the most dedicated researchers unless more domesticated strains are developed. P. chuxiongensis, P. pseudoaztecorum have been circulating around for a decade, but have never become popular. The Myc Check podcast did reveal that authentic P. natalensis can apparently form sclerotia after several months of incubation. Which is exciting and maybe that will make it more desirable.

Happy Mushrooming!

-John Workman

This saga represents the sample we currently offer known as ATL#7. Along with comparison tools like MycoMap and NCBI BLAST, on-demand Sanger sequencing services such as Genewiz have ensured that a science that was once relegated to academics in universities is now available to anyone with a rudimentary DNA extraction lab and PCR thermocycler. For under $500, and a basic knowledge of sterile technique, anyone can extract fungal DNA for professional analysis.While deep sequencing of an entire genome is possible with the right tools, and there are reasons to dive this far into the genetic maze of a fungal species, there are a handful of specific genes that are generally sequenced in order to tease apart species. The most commonly sequenced gene in fungi is called ITS - the Internal Transcribed Spacer gene, which is a specific section of DNA in the fungal genome that is highly variable, even among very closely related species.The process for identifying a species based on ITS goes like this:

1. Clean mycelium or fruit body is ground in a lysis solution,
2. Heated on a heat block,
3. Centrifuged and decanted,
4. Mixed with ITS primers and Taq polymerase,
5. Thermocycled (PCR), and
6. Sanger sequenced to determine order of nucleotides.

What you end up with is a large enough amount of the ITS region of DNA in the sample in order to get a clear and reproducible sequence. These samples can be either sequenced at home using a nanopore sequencer, or sent in to one of several on-demand sequencing companies for Sanger sequencing.New and exciting species are being discovered every day, and extracting DNA for sequencing is easy and fun! There are about 14,000 species of mushrooms known to science, and around 150,000 species of fungi described, while it is estimated that there are as many as 11,000,000 species of fungi living on Earth. Considering these numbers, the likelihood that you will encounter an undescribed species in your daily life is nearly a certainty. With just a few tools, and a little practice, you could introduce the world to an organism that has never before been described by science.Here are a few DNA sequences of the samples we offer here at Sporeworks:

Psilocybe azurescens:

GTTGTAGCTGGTCCTCTCGGGGGCATGTGCTCGCCTGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGAAACTGGATAGGAGAGGGACTTGTCCTTCAAGTTAAAGGTTTTTCGGCGCTCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATCTTATGGCTTTATGCCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTCTTTTGCCGGCTTCTCTCGAGATGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGACGTCTGCTCTCAATGGGTTGAAGCTGCTTCTAACCGTCCGTTCATTCGGACAGCACATAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Psilocybe tampanensis ATL#7:

TTGACTTGGTTGTAGCTGGTCCTCTAGGGGACATGTGCTCGCCTTGTCATCTTTATCTATCCACCTGTGAACCTTTTGTAGACTTGGAACTAGTGAATGGGAGAGCATGCTCTCTTTGAAGCTATACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTTTCATTTGCTGGCTTCTGTCGGCTCCCCTCAAATGCATTAGCTGGTACCCCGCGCGGAGCCGTCTATTAGTGTGATAATTATCTACGCTGTGGACATCTGCATCAATGGGATTGTACTGCTTCTAACCGTCCATTTACTGGACAATACAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGC

Psilocybe subtropicalis:

AGCTGGTCCTCTCGGGGGCATGTGCTCGCTGTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGGACTAGTGAACGGGAGAGCTTGCTCTCCTAGAAGCTACACCAGGCCTATGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTGCTGGCTCTAGTCGGCTCCCCTCAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTTTCATGGACAACTTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA

Psilocybe aff. natalensis:

CGTGGTTGTAGCTGGCCCTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATTTCCACCTGTGCACTTTTTGTAGATCATTGTTTTTGGAAGTTGGATTGAAGTCAGAGAGTAATCTCTGATGAATTGAAGGCTTTCTCAATGGTGGTCTACGTTTTCATATACTCCAATGAATGTAACAGAATGTATCTATATGGCCTTGTGCCTATAAAACAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGTTAGCTTGTGTAATGGCTTGGACTTGGGGGTTTATTTTGCCGGCTTCTTACGAAGTCAGCTCCCCTTAAATGCATTAGCCGGCTGCCCGCTGTGGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTCTGCTATTAATGGGTTGAAGCTGCTTCAAACCGTCTGTTTACTCAGACAATTAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA

Panaeolus bisporus:

TGATTTGAGGTCAATGGTTCAAGTTGTCCCAATAACAGGACAGTTAGAAGCAGGGCAAACACCTTTTTACAGCAATCCTTAAACCCACGGCGTAGATAATTATCACACCAATAGATAGGTTTGCGCGGGGCACCCACTAATTCATTTGAGAGGAGCAGACTTTTGACAGCCTGCAGAAAACCTCCACATCCAAGCCATCATCACAAAAGTGATGAGGTTGAGAATTTAATGACACTCAAACAGGCATGCTCGTCGGAATACCAACGAGCGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTATATAGTTTATAGGCTAATGCCCATTGATTCGTTCTGTTACTTTCTATAGTGTATGTGTAAAAATACATAGGACCTGGGAATGAATGAAGCCGTTCAGAGAGTTACCTCCATTACAAGACTTCCCCCAGACCTACAGTGTGTGCACAGGTGGATAAACAAAAAAGGCAGATGCGTGCACAAAATTCCCCCGAGAGGGACAGCAACAGCTTCTACCTAGTTTATTCGATAATGATCCTTCCGCAGGTTCACCCTACGGA

Psilocybe subtropicalis (P. semperviva)

Happy Mushrooming!

-Sporeworks

The podcast is currently available to subscribers of the Hamilton Morris Podcast on Patreon and Spotify. 

Hamilton's summary of the interview:

• This is the first recorded interview with mycological legend and Sporeworks entrepreneur John Workman, we discuss his discovery of Albino Penis Envy, bioluminescent petunias with mushroom genes, attempts to cultivate the nipple king Psilocybe hoogshagenii, and his spores being sent to the International Space Staton.

The podcast presents an in-depth discussion on many interesting topics including the development of the Albino Penis Envy strain of Psilocybe cubensis and the proliferation of sclerotia producing varieties like the Psilocybe tampanensis : ATL#7 in European markets. They dive into a variety of exotic psilocybe mushrooms, discussing the challenges, changes, and the new science assisting in proper taxonomy.

The interview also provides fascinating history behind the development of online mushrooms communities, spore vending, and current trends in the "mushroom space." Speaking of space, Workman also addresses Sporeworks recent involvement in helping provide spore material for tests aboard the International Space Station!

We're deeply humbled by Hamilton's feature of John Workman on his podcast, providing a chance to share a little bit of his history and the Sporeworks story. 

From John, "It was an honor to be recognized by Hamilton Morris and he did everything possible to make the interview an enjoyable experience."

Happy Mushrooming!

-Sporeworks 

On the first day of every month the Spore Works Lab releases a limited quantity of mushroom spore or culture material from rare, interesting, and exotic varieties. These represent the ongoing efforts of our dedicated team towards collection, taxonomy, and species/strain development, and are offered at a discount to encourage further investigation. 

Your patronage ensures the continued research and development of these wonderful mushroom varieties, thank you for your support. Quantities are limited, as new features will be announced and rotated each month.

Below is a list of previous (and current) Spore Works Lab Monthly Features -

September 2023 - Psilocybe cubensis : Golden Halo Spore Syringe

October 2023 - Psilocybe cubensis : Penis Envy #6 PE6 Spore Syringe 

November 2023 - Psilocybe cubensis : Fiji Spore Syringe

December 2023 - Psilocybe cubensis : African Transkei Spore Syringe

• NOTE: This strain is currently available as part of our standard Psilocybe cubensis Spore Syringe inventory. Available and ready to ship!

January 2024 - Panaeolus (Copelandia) cyanescens : RDU (Red Down Under) Spore Syringe

February 2024 - Psilocybe cubensis : Palenque Spore Syringe

March 2024 - Psilocybe cubensis : Corumba Brazil Spore Syringe

• NOTE: This strain is currently available as part of our standard Psilocybe cubensis Spore Syringe inventory. Available and ready to ship!

April 2024 - Psilocybe cubensis : Rusty Whyte Spore Syringe

May 2024 - Psilocybe cubensis : B+ Classic Spore Syringe

June 2024 - Psilocybe cubensis : Mexican Dutch King (MDK) Spore Syringe

• NOTE: This strain is currently available as part of our standard Psilocybe cubensis Spore Syringe inventory. Available and ready to ship!

July - August 2024 - Psilocybe cubensis : Cambodian Spore Syringe

• NOTE: This strain is currently available as part of our standard Psilocybe cubensis Spore Prints inventory. Available and ready to ship!

September 2024 - Psilocybe mexicana : Strain-X Spore Syringe

October 2024 - Psilocybe cubensis : El Choco Spore Syringe

November 2024 - Psilocybe cubensis : McKennaii Spore Syringe

• NOTE: This strain is currently available as part of our standard Psilocybe cubensis Spore Syringe inventory. Available and ready to ship!

December 2024 - Psilocybe allenii : Cyclone Psilocybe Spore Syringe

• NOTE: This strain is currently available as part of our standard Exotic Psilocybin Species Spore Syringe inventory. Available and ready to ship!

January 2025 - Psilocybe cubensis : A+ (A-strain) Spore Syringe

February 2025 - Psilocybe cubensis : Koh Samui Spore Syringe

March 2025 - Psilocybe antioquiensis : Siem Reap, Cambodia Spore Syringe

April 2025 - Psilocybe cubensis : Jedi Mind Fuck Spore Syringe

May 2025 - Psilocybe cubensis : Z Strain Spore Syringe

- Cheers, and happy mushrooming!

The Corumba Brazil strain is now included in our full time Ps. cubensis Spore Syringe inventory and available for purchase at discount in our Psilocybe cubensis : Customer's Choice 4 Pack as well as in Wholesale and Bulk bundles.

Spore Works Lab Monthly Feature Update:

The Spore Works Monthly Lab Features will now be released on the first day of each month. For the remainder of August we will continue to feature the highly popular Cambodian Strain of Psilocybe cubensis. Look for our next exciting Spore Works Lab Feature update on September 1.

On the first day of every month, Spore Works Lab will releases a limited quantity of mushroom spore or culture material from rare, interesting, and exotic varieties. These represent the ongoing efforts of our dedicated team towards collection, taxonomy, and species/strain development, and are offered at a discount to encourage further investigation. Your patronage ensures the continued research and development of these wonderful mushroom varieties, thank you for your support. Quantities are limited, as new features will be announced and rotated each month.

With our next Monthly Feature we will also be publishing a Blog to maintain a list of previous Monthly Features, and links to those species/strains with their details and information. For those curious about past features, this will serve as a great resource. We look forward to adding more exciting Monthly Features and we deeply appreciate your continued patronage and support. It makes this all possible!

-Sporeworks

This past year, we were given the opportunity to participate in an experiment allowing our spore materials to reach unprecedented heights, and a new frontier in the science of Psilocybe mushrooms. On March 21st, 2024, a number of our spore samples were aboard the SpaceX Cargo Dragon C209 spacecraft for NASA’s CRS-30 research mission, having lifted off March 21st from the Cape Canaveral Space Force Station. Two days later, the Cargo Dragon docked with the International Space Station and the samples boarded the orbiting laboratory. There they stayed for the following month, before undocking on the 26th of April and returning to Earth! As far as we know, this is the first time the genus Psilocybe has been to space and returned back to Earth safely.

An overview of some of the research was presented at the 2024 ISSRDC, an international conference on scientific work being conducted on the International Space Station. Several papers are forthcoming utilizing the data gathered, and we will be sure to post those as they are published, if and as soon as we have permission from the authors to do so.

In the meantime, we will be working with some of the materials as they return to us from the mission, and hope to some day soon offer a wholly unique, stellar variety of spora for your own research and study. Thanks to everyone involved in making the project a reality.

Happy Mushrooming folks, and keep reaching for the stars!

-Sporeworks

Sporeworks has been collecting, cataloging, and offering rare and exotic mushroom spores as prints and syringes, since 1998. During this time, we have perfected the art and science of producing clean, stable, and reliable products. So reliable, in fact, we feel confident guaranteeing them. Even offering free replacements to any customer who encounters an issue with their spores

We continue offering our products in their spore form only because we believe them to be a superior product to the isolated and nutrient-rich cultures that others offer. Isolated cell lines create genetic bottlenecks that degrade the organism’s ability to adapt to variable environments and disease threats. The genetic variety within a group of spores is a bulwark against variable conditions and disease

Also, cell lines that are repeatedly cultured weaken over time, a phenomenon known as cellular senescence. Yes, mycelium eventually grows old and its performance suffers! Spores are far more stable. The anatomy of a spore evolved to withstand incredible variations in temperature, humidity, light, radiation, pressure, etc. Mushroom spores can remain in a state of suspended animation for decades until the right conditions are introduced that inspire them to come alive.

Another concern is the nutrient-rich liquid the cultures are grown in. This also provides an ideal habitat for bacteria and other fungi to flourish. Liquid cultures are prone to contamination, and unfortunately without intense quality control there is no way for a producer to know an entire batch has been compromised until it is too late.

And, of course, a very important thing to consider is the unambiguous legality of our products. As per a 2024 letter from the United States Drug Enforcement Agency clarifying the issue:

“If the mushroom spores (or any other material) do not contain psilocybin or psilocin (or any other controlled substance or listed chemical), the material is considered not controlled under the CSA. However, if at any time the material contains a controlled substance such as psilocybin or psilocin (for example, upon germination), the material would be considered a controlled substance under the CSA.”

This letter very clearly states that the spores of Psilocybe species are fully legal, while the legality of the liquid cultures of these species is more uncertain. This uncertainty should provoke caution with customers purchasing material from suppliers who offer legally questionable material, as it may put their personal information at risk, should these suppliers find themselves at odds with regulatory agencies.

Because we believe in the superiority of our spore-based products, and we endeavor to not put our customers in the way of any legal peril by purchasing our products, we will continue to offer spores for microscopy, just as we have been for over 25 years.

Cheers, and happy mushrooming!

Initially, I wasn’t even thinking about mushroom breeding. While working with the PF Albino and growing a few pure white mushrooms, I decided to check out the gills under the microscope. I wanted to see if these mushrooms were spore-less, like everyone assumed. Surprisingly, spores were observed, and like the rest of the fruit body, the spores were colorless. With some effort, a light partial spore print, that was barely visible on foil, was produced from a very mature cap. The spores appeared white in deposit but there weren’t many and they were difficult to see. To check for spore viability, I placed some of the white spores on malt agar in petri dishes.

The spores germinated in only a few days. I noticed that there were very few colonies growing and they were spaced some distance apart. I assume this was due to the low number of spores and maybe low viability. The isolated germinations made me think that each colony might be from a single spore (monokaryotic). If this was true, I might be able to use these monokaryotic mycelia for breeding experiments. Maybe, even make an Albino Penis Envy! To prevent fusing with other mycelia from nearby spores and generating a dikaryotic mycelium, I quickly transferred the tiniest samples of tissue to new agar plates.

At this time, I should go over the very basics of mushroom sex for those that aren’t familiar with mushroom genetics. At its simplest, two compatible spores are needed to produce a mushroom producing dikaryotic mycelium. A mycelium generated from a single spore (monokaryotic) won’t produce mushrooms (usually) but is very useful for breeding new mushroom varieties. Crossing different monokaryotic mycelia is by simple mixing or allowing them grow together across a medium such as an agar plate.

To confirm that the mycelium was monokaryotic, a small sample was placed under the microscope to look for clamp connections. A clamp connection looks like a little bump or bulge between hyphal cells and indicates nuclear movement within a dikaryotic mycelium. A mycelium with no clamp connections should be monokaryotic, which is what I wanted to see. I want to keep this simple, so that is all I’m going to cover on clamp connections. More information and pictures can be easily found online.

At this same time, I was reading my newly acquired copy of “Genetics and Breeding of Edible Mushrooms” by A.C. Chang. I noted this passage on nuclear migration on page 47.

In many Basidiomycetes a phenomenon occurs following hyphal fusion which permits the establishment of a heterokaryotic condition in growing cells. This phenomenon is nuclear migration by which is meant the migration of nuclei through the established mycelium of a confronting strain. Nuclear migration was first described by Buller from observations of the formation of clamp connections, indicative of dikaryotic hyphae, at a distance from the site of fusion of compatible strains greater than could be explained by hyphal growth. Nuclear migration rates of different species may vary widely from 0.5mm/h in Coprinus lagopus (Buller, 1931) to 40mm/h in Coprinus congregatus (Ross, 1976). The advantage to the organism of nuclear migration is that the heterokaryotic condition is not limited to those heterokaryotic cells that have been formed by plasmogamy, but can be established rapidly in large numbers of cells and be perpetuated in the growing cells as is the case in the clamp forming dikaryotic hyphae of Basidiomycetes

I am pretty lazy and I didn't want to spend time isolating more single spores from other cubes and then do several controlled crosses and hope for the best. I was now aware of a mechanism where a monokaryotic mycelium can become a dikaryotic mycelium by nuclear migration, and not just at the new growth at the point of mycelial contact. Essentially the entire monokaryotic culture becomes dikaryotic by replicating and moving nuclei in a sort of a chain reaction through the already existing mycelial network.

Sooooooo.......... here is what I did.

I put the microscopically confirmed monokaryoitic PF Albino culture into a jar of sterile grain (grass seed in this case) and let it colonize almost completely. Every grain was covered with mycelium, but it would need a few more days to get really dense. Then I made a fresh solution (adding just dry spores also worked) of normally pigmented Penis Envy (PE) cubensis spores and injected that into the nearly colonized grain. I shook the jar to mix. The idea is to deny any uncolonized substrate to the injected PE spores for colonization if they combined (mated) with other PE spores. In theory, the PE spores will germinate and some will combine with other nearby germinated PE spores, but some will combine with the PF Albino mycelium. Nuclear migration should then transform the entire jar of monokaryotic PF Albino mycelium into several strains of dikaryotic PF Albino X Penis Envy mycelium. There shouldn't be any substrate left for any significant amount of pure Penis Envy dikaryotic mycelium to grow and later form mushrooms.

The colonized grain needs to be fruited directly and not spawned to a bulk substrate. Surprisingly, this method worked on the first attempt and produced some exceptionally normal looking Psilocybe cubensis mushrooms, with no hints of mutations or abnormalities. Since both varieties are supposedly descendants of early collections from the Amazon, this may be a glimpse into what the original mushrooms looked like when first collected.

PF Albino x Penis Envy (F1) mushrooms grown from cased grass seed. (above)

Now that we have varietal hybrid mushrooms, the hard part is over. I can just take spore prints of this generation and use them for new multi spore cultures. The first generation is genetically 50% of each parent and all the mushrooms look the same. But the later generations are where the action is, and we should expect to see all sorts of crazy combinations of traits. And that is what I observed.

A few examples of the F2 generation showing various forms. (above)

After selecting spores from promising specimens from the F2 generation, I finally got an early version of what I was looking for. An albino mushroom with a penis shaped cap in the F3 generation and another interesting form that I called the PE Uncut.

The very first Albino Penis Envy (APE) 2006

After a few more generations for stabilization and we have the APE we have today. As with the original Penis Envy, the reduced caps don’t produce or release many spores. But spores are present and can be swabbed from the gills in adequate amounts for propagation. I also developed an in-house method of separating and concentrating spores with a centrifuge for syringes.

I created the APE purely with aesthetics in mind and didn’t intend to produce a super potent variety of Psilocybe cubensis. Anecdotal reports always rated the APE highly potent but real results finally came to light in 2022 with the advent of laboratory testing in the Psilocybin Cup by Hyphae Labs, where APE ranked at or near the top in potency.

https://www.oaklandhyphae510.com/post/oakland-hyphae-hyphae-labs-present-the-spring-psilocybin-cup-2022-final-results

And again in 2023 with Colorado’s first Psychedelic Cup.

https://www.5280.com/what-we-learned-at-colorados-first-psychedelic-cup/

John Workman

The Penis Envy: A Classic Psilocybe cubensis Variety Selected for High Potency.

The Penis Envy variety of Psilocybe cubensis is extremely popular due to its high potency and distinct phallic appearance. Originally only available from the Homestead Book Company and later the more obscure MycoTech, both of which no longer exist.

The origin story of the Penis Envy (PE) variety of cubensis was clouded in myth and mystery until Hamilton Morris’s 2021 podcast where he interviews Richard Guitierrez (Rich Gee), the developer of the PE. The podcast is now available on Youtube (https://www.youtube.com/watch?v=QRArM5Ev4EE) Originally called “Amazons” The name “Penis Envy” was coined by Gee around 1987 based on its appearance and comments by some exotic dancers. The first convincing documented photograph of the PE is on the cover of a 1995 self-published and extremely rare book titled “Cubensis Aquarium Gardening” by Rich Gee. Although the Penis Envy name isn’t used in the book, the distinctive shaped caps are unmistakable.

Cover of “Cubensis Aquarium Gardening” showing an early version of Penis Envy

As the story goes, around 1975, Gee extracted spores from dried Psilocybe cubensis Amazonian mushrooms, purchased in California. The mushrooms were claimed to be grown from the direct descendants of Terrence McKenna’s Amazonian spore collection. Gee was specifically selecting for large mushrooms with a strong bluing reaction when damaged. Blue bruising is a reasonably good indicator of potency. By 1978 or so, the original Amazon spores were incrementally improved in potency and size and acquired the reduced penis cap. Gee did not directly select for this penis shaped cap. The phallic shape appeared as a result of a random genetic mutation that was associated with high potency. Around 2000, the PE variety was becoming very well known on magic mushroom forums like the Shroomery. Since spore production was low, it was in high demand with limited supply. Sporeworks first started selling PE in 2002 after working out a method of spore extraction and concentration.

Cultivation of Psilocybe cubensis Penis Envy variety (2002)

Early attempt at microscopy of Penis Envy spores.

So now we have two mutant varieties of P. cubensis, both distinct in appearance and of high potency. Since they both looked very different from each other, it should be visually obvious if a hybridization is successful. I also thought an Albino Penis Envy (APE) would look cool. I had never done any mushroom breeding before, but I had some ideas on how to go about it. The final part of this 3-part series will cover the hybridization and selection method for the APE.

John Workman

Stay tuned for Part Three!

Part One

Over the years, since it was first released in 2006, many websites have generated their own narratives on the origin of the APE. Either through ignorance or intentional misinformation for their own purposes, the true history has been obscured by time. To set the record straight, I will document in excruciating detail the real story here. Much of this work was originally documented on the Shroomery.org forums, where much of it still remains.

The short version (TLDR) is that APE is an in-house varietal hybrid of the PF Albino and Penis Envy strains of Psilocybe cubensis generated by Sporeworks.com.

First a little ground background on the parentage of the APE.

The PF Albino: An Ultraviolet Induced Mutation by a Pioneer in Home Psilocybe cubensis Cultivation

The Psylocybe Fanaticus (PF) TEK magic mushroom revolution began in September 1991, with its introduction in High Times magazine by Robert 'Billy' Mcpherson aka Psylocybe Fanaticus. The PF TEK was an early simplified method of growing Psilocybe cubensis mushrooms using a hypodermic syringe containing mushroom spores and water (novel at the time) and small ½ pint cakes of steamed brown rice flour and vermiculite. Not requiring a pressure cooker or messy composts like earlier methods, the PF TEK opened magic mushroom cultivation to more casual hobbyists. The PF TEK became very popular as the early internet accelerated the spread of information. Unfortunately, Psylocybe Fanaticus was raided and shut down in February 2003. Further details of the raid is on this archive of the original website (https://www.seanet.com/~rwmcpherson/pfcase.htm). Sadly, Robert 'Billy' Mcpherson died in 2011 at the age of 65.

The PF Albino was a chance mutation of the standard PF Classic strain (aka Matias Romero and Amazonian) of Psilocybe cubensis sold by Psylocybe Fanaticus. The PF Classic was selected specifically to do well using the PF TEK method. Around the year 2000, for unstated reasons, PF started using fluorescent UV lights during his PF Classic production runs. The UV exposure unintentionally induced albinism and eventually caused enough genetic damage that fruiting was impossible. Prints of UV exposed pigmented mushrooms, that were growing on the same PF cakes as the albinos, were distributed on a limited basis. It was hoped that the albinism trait was present in these normal looking spores and would be revealed in later multispore cultures. This was indeed true, and PF albino mushrooms began to circulate in the magic mushroom community. I was gifted a UV exposed PF print and started working with it in 2005. PF assumed that the PF Albino was sporeless, but I was able to find colorless spores on the gills. Albino spores were essential to what was to come.

Microscopy of the gill of PF Albino showing 4-spored basidia with unpigmented spores

PF Classic grown from UV exposed spores 

Clone of Albino form

Stay tuned for Part Two...

Speaking of new data and content, we're also super excited to be focusing our efforts on increasing taxonomy, species development, and publication of data on this new slick v5 Sporeworks.com website. Be sure to check out the LINKS section of our navigation bar, as it holds the keys to our expanding photo gallery, blog, reference list, and much more to come! 

Be sure to check this Blog/News space often for updates, news, and fresh releases from our developmental lab and production facilities! For more frequent updates and info, give us a follow and the likes at: Instagram: @official.sporeworks, Facebook, and Twitter: @sporeworks.

As always, we are deeply thankful for all your support and patronage. We are truly humbled to be able to provide this service for over a quarter century. Our team is incredibly excited about new developments in this space and the opportunities it will bring! 

Best to you and yours, 

-Sporeworks.com